Human AFM(Afamin) ELISA Kit

Human AFM(Afamin) ELISA Kit

To Order: Contact us

Human Afamin (AFM) ELISA Kit
RD-AFM-Hu-48Tests 48 Tests
EUR 521

Human Afamin (AFM) ELISA Kit
RD-AFM-Hu-96Tests 96 Tests
EUR 723

Human Afamin (AFM) ELISA Kit
RDR-AFM-Hu-48Tests 48 Tests
EUR 544

Human Afamin (AFM) ELISA Kit
RDR-AFM-Hu-96Tests 96 Tests
EUR 756

Rat Afamin (AFM) ELISA Kit
DLR-AFM-Ra-48T 48T
EUR 549
  • Should the Rat Afamin (AFM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Afamin (AFM) in samples from serum, plasma or other biological fluids.

Rat Afamin (AFM) ELISA Kit
DLR-AFM-Ra-96T 96T
EUR 718
  • Should the Rat Afamin (AFM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Afamin (AFM) in samples from serum, plasma or other biological fluids.

Rat Afamin (AFM) ELISA Kit
RD-AFM-Ra-48Tests 48 Tests
EUR 557

Rat Afamin (AFM) ELISA Kit
RD-AFM-Ra-96Tests 96 Tests
EUR 775

Rat Afamin (AFM) ELISA Kit
RDR-AFM-Ra-48Tests 48 Tests
EUR 583

Rat Afamin (AFM) ELISA Kit
RDR-AFM-Ra-96Tests 96 Tests
EUR 811

Human Afamin (AFM) ELISA Kit
abx576525-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Afamin(AFM) ELISA kit
E01A1306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Afamin(AFM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Afamin(AFM) ELISA kit
E01A1306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Afamin(AFM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Afamin(AFM) ELISA kit
E01A1306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Afamin(AFM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human AFM(Afamin) ELISA Kit
EH2493 96T
EUR 567.6
  • Detection range: 3.125-200 ng/ml
  • Uniprot ID: P43652
  • Alias: AFM/ALB2 ALBAALF afamin ALB2alpha-Alb/ALBAalpha-albumin/ALF/Alpha-Alb/Alpha-albumin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 1.875 ng/ml

Human Afamin, AFM ELISA KIT
ELI-49548h 96 Tests
EUR 824

Human Afamin (AFM) ELISA Kit
20-abx150583
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Afamin (AFM) ELISA Kit
abx251862-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Human Afamin(AFM) ELISA kit
CSB-EL001419HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Afamin (AFM) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Afamin(AFM) ELISA kit
1-CSB-EL001419HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Afamin(AFM) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human AFM/ Afamin ELISA Kit
E0078Hu 1 Kit
EUR 605

Human Afamin (AFM) ELISA Kit
SEC284Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Afamin (AFM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Afamin (AFM) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Afamin (AFM) ELISA Kit
SEC284Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Afamin (AFM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Afamin (AFM) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Afamin (AFM) ELISA Kit
SEC284Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Afamin (AFM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Afamin (AFM) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Afamin (AFM) ELISA Kit
SEC284Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Afamin (AFM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Afamin (AFM) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Afamin (AFM) ELISA Kit
4-SEC284Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Afamin elisa. Alternative names of the recognized antigen: ALB2
  • ALBA
  • ALF
  • A-ALB
  • Alpha-Albumin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Afamin (AFM) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Afamin ELISA Kit (AFM)
RK00840 96 Tests
EUR 521

Human Afamin(AFM)ELISA Kit
QY-E04447 96T
EUR 400

Rat Afamin (AFM) ELISA Kit
CEC284Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Afamin (AFM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Afamin (AFM) in serum, plasma and other biological fluids.

Rat Afamin (AFM) ELISA Kit
CEC284Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Afamin (AFM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Afamin (AFM) in serum, plasma and other biological fluids.

Rat Afamin (AFM) ELISA Kit
CEC284Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Afamin (AFM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Afamin (AFM) in serum, plasma and other biological fluids.

Rat Afamin (AFM) ELISA Kit
CEC284Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Afamin (AFM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Afamin (AFM) in serum, plasma and other biological fluids.

Rat Afamin (AFM) ELISA Kit
4-CEC284Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Afamin elisa. Alternative names of the recognized antigen: ALB2
  • ALBA
  • ALF
  • A-ALB
  • Alpha-Albumin
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Rat Afamin (AFM) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Afamin (AFM) ELISA Kit
20-abx585306
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Mouse Afamin (AFM) ELISA Kit
abx573687-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Afamin (AFM) ELISA Kit
abx575097-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Goat Afamin(AFM) ELISA kit
E06A1306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Afamin(AFM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Afamin(AFM) ELISA kit
E06A1306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Afamin(AFM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Afamin(AFM) ELISA kit
E06A1306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Afamin(AFM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Afamin(AFM) ELISA kit
E02A1306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Afamin(AFM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Afamin(AFM) ELISA kit
E02A1306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Afamin(AFM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Afamin(AFM) ELISA kit
E02A1306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Afamin(AFM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Afamin(AFM) ELISA kit
E03A1306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Afamin(AFM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Afamin(AFM) ELISA kit
E03A1306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Afamin(AFM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Afamin(AFM) ELISA kit
E03A1306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Afamin(AFM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Afamin(AFM) ELISA kit
E04A1306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Afamin(AFM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Afamin(AFM) ELISA kit
E04A1306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Afamin(AFM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Afamin(AFM) ELISA kit
E04A1306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Afamin(AFM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Afamin(AFM) ELISA kit
E07A1306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Afamin(AFM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Afamin(AFM) ELISA kit
E07A1306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Afamin(AFM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Afamin(AFM) ELISA kit
E07A1306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Afamin(AFM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Afamin(AFM) ELISA kit
E09A1306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Afamin(AFM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Afamin(AFM) ELISA kit
E09A1306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Afamin(AFM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Afamin(AFM) ELISA kit
E09A1306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Afamin(AFM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Afamin(AFM) ELISA kit
E08A1306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Afamin(AFM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Afamin(AFM) ELISA kit
E08A1306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Afamin(AFM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Afamin(AFM) ELISA kit
E08A1306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Afamin(AFM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Afamin, Afm ELISA KIT
ELI-34685m 96 Tests
EUR 865

Rat Afamin (AFM) ELISA Kit
20-abx155160
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Afamin(AFM) ELISA kit
CSB-EL001419MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Afamin (AFM) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Afamin(AFM) ELISA kit
1-CSB-EL001419MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Afamin(AFM) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Afm/ Afamin ELISA Kit
E0035Ra 1 Kit
EUR 646

Mouse Afm/ Afamin ELISA Kit
E0049Mo 1 Kit
EUR 632

ELISA kit for Human AFM (Afamin)
ELK3008 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Afamin (AFM). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Afamin (AFM). Next, A
  • Show more
Description: A sandwich ELISA kit for detection of Afamin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Afamin (AFM)
KTE60955-48T 48T
EUR 332
  • Afamin is a member of the albumin gene family, which comprises four genes that localize to chromosome 4 in a tandem arrangement. These four genes encode structurally-related serum transport proteins that are known to be evolutionarily related. The pr
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Afamin (AFM) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Afamin (AFM)
KTE60955-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Afamin is a member of the albumin gene family, which comprises four genes that localize to chromosome 4 in a tandem arrangement. These four genes encode structurally-related serum transport proteins that are known to be evolutionarily related. The pr
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Afamin (AFM) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Afamin (AFM)
KTE60955-96T 96T
EUR 539
  • Afamin is a member of the albumin gene family, which comprises four genes that localize to chromosome 4 in a tandem arrangement. These four genes encode structurally-related serum transport proteins that are known to be evolutionarily related. The pr
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Afamin (AFM) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Afamin (AFM) Antibody
20-abx124286
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Afamin (AFM) Antibody
20-abx171126
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Afamin (AFM) Antibody
20-abx171127
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Afamin (AFM) Antibody
20-abx100032
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Afamin (AFM) Antibody
20-abx100033
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Afamin (AFM) Antibody
20-abx100034
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Afamin (AFM) Antibody
abx034375-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Afamin (AFM) Antibody
abx034375-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Afamin (AFM) Antibody
20-abx175292
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Afamin (AFM) Antibody
20-abx175293
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Afamin (AFM) Antibody
abx230199-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Afamin (AFM) Antibody
abx230200-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Afamin (AFM) Antibody
abx230201-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Recombinant Afamin (AFM)
4-RPC284Hu01
  • EUR 431.52
  • EUR 218.00
  • EUR 1343.20
  • EUR 514.40
  • EUR 928.80
  • EUR 352.00
  • EUR 3208.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P43652
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 23.2kDa
  • Isoelectric Point: 5.8
Description: Recombinant Human Afamin expressed in: E.coli

Recombinant Afamin (AFM)
4-RPC284Hu02
  • EUR 431.52
  • EUR 218.00
  • EUR 1343.20
  • EUR 514.40
  • EUR 928.80
  • EUR 352.00
  • EUR 3208.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P43652
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 23.6kDa
  • Isoelectric Point: 6.6
Description: Recombinant Human Afamin expressed in: E.coli

Recombinant Afamin (AFM)
4-RPC284Mu01
  • EUR 350.88
  • EUR 197.00
  • EUR 1040.80
  • EUR 413.60
  • EUR 727.20
  • EUR 298.00
  • EUR 2452.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O89020
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 23.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Afamin expressed in: E.coli

Human Afamin (AFM) CLIA Kit
20-abx493588
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Afamin (AFM) Protein
20-abx065186
  • EUR 606.00
  • EUR 258.00
  • EUR 1817.00
  • EUR 718.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Afamin (AFM) Protein
20-abx065188
  • EUR 606.00
  • EUR 258.00
  • EUR 1817.00
  • EUR 718.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Guinea pig Afamin(AFM) ELISA kit
E05A1306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Afamin(AFM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Afamin(AFM) ELISA kit
E05A1306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Afamin(AFM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Afamin(AFM) ELISA kit
E05A1306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Afamin(AFM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Rat AFM (Afamin)
ELK7030 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Afamin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Afamin (AFM)
KTE100350-48T 48T
EUR 332
  • Afamin is a member of the albumin gene family, which comprises four genes that localize to chromosome 4 in a tandem arrangement. These four genes encode structurally-related serum transport proteins that are known to be evolutionarily related. The pr
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Afamin (AFM) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Afamin (AFM)
KTE100350-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Afamin is a member of the albumin gene family, which comprises four genes that localize to chromosome 4 in a tandem arrangement. These four genes encode structurally-related serum transport proteins that are known to be evolutionarily related. The pr
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Afamin (AFM) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Afamin (AFM)
KTE100350-96T 96T
EUR 539
  • Afamin is a member of the albumin gene family, which comprises four genes that localize to chromosome 4 in a tandem arrangement. These four genes encode structurally-related serum transport proteins that are known to be evolutionarily related. The pr
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Afamin (AFM) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Afm ELISA Kit| Rat Afamin ELISA Kit
EF018303 96 Tests
EUR 689

Afm ELISA Kit| Mouse Afamin ELISA Kit
EF014169 96 Tests
EUR 689

Rat Afamin (AFM) CLIA Kit
20-abx490460
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Afamin (AFM) Protein
20-abx652426
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Afamin (AFM) Protein
20-abx065187
  • EUR 495.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 578.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Afamin (AFM) Antibody (FITC)
20-abx273896
  • EUR 495.00
  • EUR 258.00
  • EUR 1455.00
  • EUR 676.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Afamin (AFM) Antibody (Biotin)
20-abx274319
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Afamin (AFM) Antibody Pair
20-abx370436
  • EUR 1748.00
  • EUR 1121.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Afamin (AFM) Antibody Pair
20-abx370713
  • EUR 1595.00
  • EUR 1024.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Afamin (AFM) Antibody (Biotin)
20-abx272825
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

OVA Conjugated Afamin (AFM)
4-CPC284Ra21
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Rat Afamin expressed in: chemical synthesis

Afamin (AFM) Polyclonal Antibody (Human)
4-PAC284Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AFM (Leu22~Thr210)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Afamin (AFM)

Afamin (AFM) Polyclonal Antibody (Human)
4-PAC284Hu02
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AFM (Gln211~Glu403)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Afamin (AFM)

Afamin (AFM) Polyclonal Antibody (Mouse)
4-PAC284Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AFM (Thr210~Glu403)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Afamin (AFM)

Afamin (AFM) Polyclonal Antibody (Human), APC
4-PAC284Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AFM (Leu22~Thr210)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Afamin (AFM). This antibody is labeled with APC.

Afamin (AFM) Polyclonal Antibody (Human), Biotinylated
4-PAC284Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AFM (Leu22~Thr210)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Afamin (AFM). This antibody is labeled with Biotin.

Afamin (AFM) Polyclonal Antibody (Human), Cy3
4-PAC284Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AFM (Leu22~Thr210)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Afamin (AFM). This antibody is labeled with Cy3.

Afamin (AFM) Polyclonal Antibody (Human), FITC
4-PAC284Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AFM (Leu22~Thr210)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Afamin (AFM). This antibody is labeled with FITC.

Afamin (AFM) Polyclonal Antibody (Human), HRP
4-PAC284Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AFM (Leu22~Thr210)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Afamin (AFM). This antibody is labeled with HRP.

Afamin (AFM) Polyclonal Antibody (Human), PE
4-PAC284Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AFM (Leu22~Thr210)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Afamin (AFM). This antibody is labeled with PE.

Afamin (AFM) Polyclonal Antibody (Human), APC
4-PAC284Hu02-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AFM (Gln211~Glu403)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Afamin (AFM). This antibody is labeled with APC.

Afamin (AFM) Polyclonal Antibody (Human), Biotinylated
4-PAC284Hu02-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AFM (Gln211~Glu403)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Afamin (AFM). This antibody is labeled with Biotin.

Afamin (AFM) Polyclonal Antibody (Human), Cy3
4-PAC284Hu02-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AFM (Gln211~Glu403)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Afamin (AFM). This antibody is labeled with Cy3.

Afamin (AFM) Polyclonal Antibody (Human), FITC
4-PAC284Hu02-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AFM (Gln211~Glu403)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Afamin (AFM). This antibody is labeled with FITC.

Afamin (AFM) Polyclonal Antibody (Human), HRP
4-PAC284Hu02-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AFM (Gln211~Glu403)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Afamin (AFM). This antibody is labeled with HRP.

Afamin (AFM) Polyclonal Antibody (Human), PE
4-PAC284Hu02-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AFM (Gln211~Glu403)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Afamin (AFM). This antibody is labeled with PE.

Afamin (AFM) Polyclonal Antibody (Human), APC-Cy7
4-PAC284Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AFM (Leu22~Thr210)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Afamin (AFM). This antibody is labeled with APC-Cy7.

Afamin (AFM) Polyclonal Antibody (Human), APC-Cy7
4-PAC284Hu02-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AFM (Gln211~Glu403)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Afamin (AFM). This antibody is labeled with APC-Cy7.

Afamin (AFM) Polyclonal Antibody (Mouse), APC
4-PAC284Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AFM (Thr210~Glu403)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Afamin (AFM). This antibody is labeled with APC.

Afamin (AFM) Polyclonal Antibody (Mouse), Biotinylated
4-PAC284Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AFM (Thr210~Glu403)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Afamin (AFM). This antibody is labeled with Biotin.

Afamin (AFM) Polyclonal Antibody (Mouse), Cy3
4-PAC284Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AFM (Thr210~Glu403)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Afamin (AFM). This antibody is labeled with Cy3.

Afamin (AFM) Polyclonal Antibody (Mouse), FITC
4-PAC284Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AFM (Thr210~Glu403)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Afamin (AFM). This antibody is labeled with FITC.

Afamin (AFM) Polyclonal Antibody (Mouse), HRP
4-PAC284Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AFM (Thr210~Glu403)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Afamin (AFM). This antibody is labeled with HRP.

Afamin (AFM) Polyclonal Antibody (Mouse), PE
4-PAC284Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AFM (Thr210~Glu403)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Afamin (AFM). This antibody is labeled with PE.

Afamin (AFM) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC284Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AFM (Thr210~Glu403)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Afamin (AFM). This antibody is labeled with APC-Cy7.

Afm/ Rat Afm ELISA Kit
ELI-49682r 96 Tests
EUR 886

Human AFM ELISA Kit
ELA-E9608h 96 Tests
EUR 824

AFM ELISA KIT|Human
EF006527 96 Tests
EUR 689

Human Afamin PicoKine ELISA Kit
EK1487 96 wells
EUR 425
Description: For quantitative detection of human Afamin in cell culture supernates, serum and urine.

ELISA kit for Human Afamin
EK5002 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Afamin in samples from serum, plasma, tissue homogenates and other biological fluids.

AFM ELISA Kit (Human) (OKAN05993)
OKAN05993 96 Wells
EUR 792
Description: Description of target: This gene is a member of the albumin gene family, which is comprised of four genes that localize to chromosome 4 in a tandem arrangement. These four genes encode structurally-related serum transport proteins that are known to be evolutionarily related. The protein encoded by this gene is regulated developmentally, expressed in the liver and secreted into the bloodstream.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.48 ng/mL

AFM ELISA Kit (Human) (OKBB01022)
OKBB01022 96 Wells
EUR 505
Description: Description of target: Afamin is a protein that in humans is encoded by the AFM gene. This gene is a member of the albumin gene family, which is comprised of four genes that localize to chromosome 4 in a tandem arrangement. These four genes encode structurally-related serum transport proteins that are known to be evolutionarily related. The protein encoded by this gene is regulated developmentally, expressed in the liver and secreted into the bloodstream. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

AFM ELISA Kit (Human) (OKCD08066)
OKCD08066 96 Wells
EUR 975
Description: Description of target: AFM is a member of the albumin gene family, which is comprised of four genes that localize to chromosome 4 in a tandem arrangement. These four genes encode structurally-related serum transport proteins that are known to be evolutionarily related. AFM is regulated developmentally, expressed in the liver and secreted into the bloodstream.This gene is a member of the albumin gene family, which is comprised of four genes that localize to chromosome 4 in a tandem arrangement. These four genes encode structurally-related serum transport proteins that are known to be evolutionarily related. The protein encoded by this gene is regulated developmentally, expressed in the liver and secreted into the bloodstream.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 1.45ng/mL

Recombinant human Afamin
P1466 100ug Ask for price
  • Uniprot ID: P43652
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Afamin

AFM ELISA Kit (Mouse) (OKEH06475)
OKEH06475 96 Wells
EUR 727
Description: Description of target: Vitamin E binding protein. May transport vitamin E in body fluids under conditions where the lipoprotein system is not sufficient or across the blood-brain barrier.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.312 ng/mL

AFM ELISA Kit (Rat) (OKEH06476)
OKEH06476 96 Wells
EUR 727
Description: Description of target: Vitamin E binding protein. May transport vitamin E in body fluids under conditions where the lipoprotein system is not sufficient. May be involved in the regulation and transport of vitamin E at the blood-brain barrier.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.314 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202

Afamin Antibody
abx430692-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Afamin antibody
70R-5299 50 ug
EUR 467
Description: Rabbit polyclonal Afamin antibody raised against the middle region of AFM

Recombinant Human AFM
P0508 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P43652
Description: Recombinant Human protein for AFM

AFM ELISA Kit (Human) : 96 Wells (OKEH01984)
OKEH01984 96 Wells
EUR 727
Description: Description of target: This gene is a member of the albumin gene family, which is comprised of four genes that localize to chromosome 4 in a tandem arrangement. These four genes encode structurally-related serum transport proteins that are known to be evolutionarily related. The protein encoded by this gene is regulated developmentally, expressed in the liver and secreted into the bloodstream.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL

AFM siRNA
20-abx900216
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AFM siRNA
20-abx906959
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AFM siRNA
20-abx906960
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AFM antibody
70R-8008 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal AFM antibody

anti-AFM
YF-PA10110 50 ug
EUR 363
Description: Mouse polyclonal to AFM

Human AFM shRNA Plasmid
20-abx950122
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

AFM Recombinant Protein (Human)
RP036505 100 ug Ask for price

Afamin Protein (OVA)
20-abx165504
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Afamin Blocking Peptide
33R-3492 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AFM antibody, catalog no. 70R-5299

anti- AFM antibody
FNab00199 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:5000
  • Immunogen: afamin
  • Uniprot ID: P43652
  • Gene ID: 173
  • Research Area: Cancer, Metabolism
Description: Antibody raised against AFM

anti- AFM antibody
FNab00200 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:10000
  • IP: 1:1000-1:10000
  • Immunogen: afamin
  • Uniprot ID: P43652
  • Gene ID: 173
  • Research Area: Cancer, Metabolism
Description: Antibody raised against AFM

anti- AFM antibody
FNab00201 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IP: 1:200-1:2000
  • IHC: 1:20-1:200
  • Immunogen: afamin
  • Uniprot ID: P43652
  • Gene ID: 173
  • Research Area: Cancer, Metabolism
Description: Antibody raised against AFM

AFM Rabbit pAb
A15252-100ul 100 ul
EUR 308

AFM Rabbit pAb
A15252-200ul 200 ul
EUR 459

AFM Rabbit pAb
A15252-20ul 20 ul
EUR 183

AFM Rabbit pAb
A15252-50ul 50 ul
EUR 223

AFM Rabbit pAb
A15253-100ul 100 ul
EUR 308

AFM Rabbit pAb
A15253-200ul 200 ul
EUR 459

AFM Rabbit pAb
A15253-20ul 20 ul
EUR 183

AFM Rabbit pAb
A15253-50ul 50 ul
EUR 223

AFM Blocking Peptide
33R-3688 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AFM antibody, catalog no. 70R-8008

AFM Polyclonal Antibody
28885-100ul 100ul
EUR 252

AFM Polyclonal Antibody
28885-50ul 50ul
EUR 187

AFM Polyclonal Antibody
28886-100ul 100ul
EUR 252

AFM Polyclonal Antibody
28886-50ul 50ul
EUR 187

AFM cloning plasmid
CSB-CL001419HU-10ug 10ug
EUR 614
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1800
  • Sequence: ATGAAACTACTAAAACTTACAGGTTTTATTTTTTTCTTGTTTTTTTTGACTGAATCCCTAACCCTGCCCACACAACCTCGGGATATAGAGAACTTCAATAGTACTCAAAAATTTATAGAAGATAATATTGAATACATCACCATCATTGCATTTGCTCAGTATGTTCAGGAAGCAA
  • Show more
Description: A cloning plasmid for the AFM gene.

Anti-AFM antibody
PAab00199 100 ug
EUR 355

Anti-AFM antibody
PAab00200 100 ug
EUR 355

Anti-AFM antibody
STJ117447 100 µl
EUR 277
Description: This gene is a member of the albumin gene family, which is comprised of four genes that localize to chromosome 4 in a tandem arrangement. These four genes encode structurally-related serum transport proteins that are known to be evolutionarily related. The protein encoded by this gene is regulated developmentally, expressed in the liver and secreted into the bloodstream.

Anti-AFM antibody
STJ117448 100 µl
EUR 277
Description: This gene is a member of the albumin gene family, which is comprised of four genes that localize to chromosome 4 in a tandem arrangement. These four genes encode structurally-related serum transport proteins that are known to be evolutionarily related. The protein encoded by this gene is regulated developmentally, expressed in the liver and secreted into the bloodstream.

Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

AFM ORF Vector (Human) (pORF)
ORF012169 1.0 ug DNA
EUR 354

PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

AFM Polyclonal Conjugated Antibody
C28885 100ul
EUR 397

AFM Polyclonal Conjugated Antibody
C28886 100ul
EUR 397

Human AFM(Afamin) ELISA Kit

Scroll to Top