Human KLK2(Kallikrein 2) ELISA Kit

Human KLK2(Kallikrein 2) ELISA Kit

To Order: Contact us

Human Kallikrein 2 (KLK2) ELISA Kit
DLR-KLK2-Hu-96T	DL Develop	96T	EUR 673
Should the Human Kallikrein 2 (KLK2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 2 (KLK2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Kallikrein 2 (KLK2) ELISA Kit
RD-KLK2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Kallikrein 2 (KLK2) ELISA Kit
RD-KLK2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Kallikrein 2 (KLK2) ELISA Kit
RDR-KLK2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Kallikrein 2 (KLK2) ELISA Kit
RDR-KLK2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Kallikrein 2 (KLK2) ELISA Kit
abx570610-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human KLK2/ Kallikrein-2 ELISA Kit
E1388Hu	Sunlong	1 Kit	EUR 571

Human KLK2(Kallikrein-2) ELISA Kit
EH0818	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P20151 Alias: KLK2(Kallikrein-2)/Glandular kallikrein-1(hGK-1)/Tissue kallikrein-2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Kallikrein 2 (KLK2) ELISA Kit
20-abx152088	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Kallikrein 2 (KLK2) ELISA Kit
SED108Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 2 (KLK2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 2 (KLK2) in serum, plasma, tissue homogenates and other biological fluids.

Human Kallikrein 2 (KLK2) ELISA Kit
SED108Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 2 (KLK2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 2 (KLK2) in serum, plasma, tissue homogenates and other biological fluids.

Human Kallikrein 2 (KLK2) ELISA Kit
SED108Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 2 (KLK2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 2 (KLK2) in serum, plasma, tissue homogenates and other biological fluids.

Human Kallikrein 2 (KLK2) ELISA Kit
SED108Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 2 (KLK2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 2 (KLK2) in serum, plasma, tissue homogenates and other biological fluids.

Human Kallikrein 2 (KLK2) ELISA Kit
4-SED108Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Kallikrein 2 elisa. Alternative names of the recognized antigen: KLK2A2 HK2 Prostatic Kallikrein-Related Peptidase 2 Glandular kallikrein-1 Tissue kallikrein-2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Kallikrein 2 (KLK2) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Kallikrein 2 ELISA Kit (KLK2)
RK01730	Abclonal	96 Tests	EUR 521

Human Kallikrein-2 (KLK2)
1-CSB-EP012453HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 30.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Kallikrein-2(KLK2) expressed in E.coli

ELISA kit for Human KLK2 (Kallikrein 2)
ELK3015	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kallikrein 2 (KLK2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kallikrein 2 ( Show more
Description: A sandwich ELISA kit for detection of Kallikrein 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Kallikrein-2 (KLK2)
KTE61898-48T	Abbkine	48T	EUR 354
Kallikrein-2 is a protein encoded by the KLK2 gene.The glandular kallikreins are a distinct group of serine proteases with molecular masses of 25,000 to 40,000 and an ability to release vasoactive peptides from kininogen in vitro, although the kinino Show more
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-2 (KLK2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Kallikrein-2 (KLK2)
KTE61898-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Kallikrein-2 is a protein encoded by the KLK2 gene.The glandular kallikreins are a distinct group of serine proteases with molecular masses of 25,000 to 40,000 and an ability to release vasoactive peptides from kininogen in vitro, although the kinino Show more
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-2 (KLK2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Kallikrein-2 (KLK2)
KTE61898-96T	Abbkine	96T	EUR 572
Kallikrein-2 is a protein encoded by the KLK2 gene.The glandular kallikreins are a distinct group of serine proteases with molecular masses of 25,000 to 40,000 and an ability to release vasoactive peptides from kininogen in vitro, although the kinino Show more
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-2 (KLK2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Kallikrein 2 (KLK2) CLIA Kit
20-abx494096	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Kallikrein 2 (KLK2) Antibody
20-abx126062	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Kallikrein 2 (KLK2) Antibody
20-abx128985	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Kallikrein 2 (KLK2) Antibody
20-abx002174	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Kallikrein 2 (KLK2) Antibody
20-abx132391	Abbexa	EUR 342.00 EUR 857.00 EUR 439.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Kallikrein 2 (KLK2) Antibody
abx032798-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Kallikrein 2 (KLK2) Antibody
abx032798-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Kallikrein 2 (KLK2) Antibody
abx215930-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Kallikrein 2 (KLK2) Antibody
20-abx339907	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Kallikrein 2 (KLK2) Antibody
20-abx339968	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Kallikrein 2 (KLK2) Antibody
20-abx334032	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Kallikrein 2 (KLK2) Antibody
abx432898-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Kallikrein 2 (KLK2) Antibody
abx234458-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Recombinant Kallikrein 2 (KLK2)
4-RPD108Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P20151 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 30.7kDa Isoelectric Point: Inquire
Description: Recombinant Human Kallikrein 2 expressed in: E.coli

Recombinant Kallikrein 2 (KLK2)
4-RPD108Hu02	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P20151 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 30.6kDa Isoelectric Point: 7.1
Description: Recombinant Human Kallikrein 2 expressed in: E.coli

Recombinant Kallikrein 2 (KLK2)
4-RPD108Hu03	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P20151 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 30.6kDa Isoelectric Point: 7.1
Description: Recombinant Human Kallikrein 2 expressed in: E.coli

Recombinant Kallikrein 2 (KLK2)
4-RPD108Hu04	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P20151 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 30.6kDa Isoelectric Point: 7.1
Description: Recombinant Human Kallikrein 2 expressed in: E.coli

Human Kallikrein 2 (KLK2) Protein
20-abx166693	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Kallikrein-2 (KLK2) Antibody
32231-05111	AssayPro	150 ug	EUR 261

Kallikrein 2 (KLK2) Antibody (HRP)
20-abx336219	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Kallikrein 2 (KLK2) Antibody (FITC)
20-abx336220	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Kallikrein 2 (KLK2) Antibody (Biotin)
20-abx336221	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-Kallikrein 2/KLK2 Antibody
A03879	BosterBio	100ug/vial	EUR 334

Anti-Kallikrein 2/KLK2 Antibody
PA1626	BosterBio	100ug/vial	EUR 334

KLK2 Kallikrein-2 Human Recombinant Protein
PROTP20151	BosterBio	Regular: 20ug	EUR 317
Description: KLK2 Human Recombinant produced in E. coli is a single polypeptide chain containing 260 amino acids (25-261) and having a molecular mass of 28.5kDa. KLK2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Kallikrein 2 (KLK2) Monoclonal Antibody (Human)
4-MAD108Hu21	Cloud-Clone	EUR 255.00 EUR 2642.00 EUR 655.00 EUR 322.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Pro19~Pro261 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Kallikrein 2 (KLK2)

Recombinant Human Kallikrein 2/KLK2 (C-6His)
C616-10ug	Novoprotein	10ug	EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM Citrate, 150mM NaCl, pH 3.5.

Recombinant Human Kallikrein 2/KLK2 (C-6His)
C616-1mg	Novoprotein	1mg	EUR 2486
Description: Supplied as a 0.2 μm filtered solution of 20mM Citrate, 150mM NaCl, pH 3.5.

Recombinant Human Kallikrein 2/KLK2 (C-6His)
C616-500ug	Novoprotein	500ug	EUR 1755
Description: Supplied as a 0.2 μm filtered solution of 20mM Citrate, 150mM NaCl, pH 3.5.

Recombinant Human Kallikrein 2/KLK2 (C-6His)
C616-50ug	Novoprotein	50ug	EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM Citrate, 150mM NaCl, pH 3.5.

Human Kallikrein-2 (KLK2) Antibody (Biotin Conjugate)
32231-05121	AssayPro	150 ug	EUR 369

Kallikrein 2 (KLK2) Polyclonal Antibody (Human, Rat)
4-PAD108Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK2 (Pro19~Pro261) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Kallikrein 2 (KLK2)

Kallikrein 2 (KLK2) Monoclonal Antibody (Human), APC
4-MAD108Hu21-APC	Cloud-Clone	EUR 358.00 EUR 3455.00 EUR 957.00 EUR 458.00 EUR 224.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Pro19~Pro261 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Kallikrein 2 (KLK2). This antibody is labeled with APC.

Kallikrein 2 (KLK2) Monoclonal Antibody (Human), Biotinylated
4-MAD108Hu21-Biotin	Cloud-Clone	EUR 320.00 EUR 2592.00 EUR 760.00 EUR 394.00 EUR 223.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Pro19~Pro261 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Kallikrein 2 (KLK2). This antibody is labeled with Biotin.

Kallikrein 2 (KLK2) Monoclonal Antibody (Human), Cy3
4-MAD108Hu21-Cy3	Cloud-Clone	EUR 435.00 EUR 4565.00 EUR 1235.00 EUR 569.00 EUR 258.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Pro19~Pro261 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Kallikrein 2 (KLK2). This antibody is labeled with Cy3.

Kallikrein 2 (KLK2) Monoclonal Antibody (Human), FITC
4-MAD108Hu21-FITC	Cloud-Clone	EUR 306.00 EUR 2784.00 EUR 786.00 EUR 386.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Pro19~Pro261 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Kallikrein 2 (KLK2). This antibody is labeled with FITC.

Kallikrein 2 (KLK2) Monoclonal Antibody (Human), HRP
4-MAD108Hu21-HRP	Cloud-Clone	EUR 327.00 EUR 3011.00 EUR 846.00 EUR 413.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Pro19~Pro261 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Kallikrein 2 (KLK2). This antibody is labeled with HRP.

Kallikrein 2 (KLK2) Monoclonal Antibody (Human), PE
4-MAD108Hu21-PE	Cloud-Clone	EUR 306.00 EUR 2784.00 EUR 786.00 EUR 386.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Pro19~Pro261 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Kallikrein 2 (KLK2). This antibody is labeled with PE.

KLK2 Human, Kallikrein-2 Human Recombinant Protein, sf9
PROTP20151-1	BosterBio	Regular: 5ug	EUR 317
Description: KLK2 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 246 amino acids (25-261 aa) and having a molecular mass of 27.2kDa (Migrates at 28-40kDa on SDS-PAGE under reducing conditions).;KLK2 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

Human Kallikrein-2 (KLK2) AssayLite Antibody (FITC Conjugate)
32231-05141	AssayPro	150 ug	EUR 428

Human Kallikrein-2 (KLK2) AssayLite Antibody (RPE Conjugate)
32231-05151	AssayPro	150 ug	EUR 428

Human Kallikrein-2 (KLK2) AssayLite Antibody (APC Conjugate)
32231-05161	AssayPro	150 ug	EUR 428

Human Kallikrein-2 (KLK2) AssayLite Antibody (PerCP Conjugate)
32231-05171	AssayPro	150 ug	EUR 471

Kallikrein 2 (KLK2) Polyclonal Antibody (Human, Rat), APC
4-PAD108Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK2 (Pro19~Pro261) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Kallikrein 2 (KLK2). This antibody is labeled with APC.

Kallikrein 2 (KLK2) Polyclonal Antibody (Human, Rat), Biotinylated
4-PAD108Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK2 (Pro19~Pro261) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Kallikrein 2 (KLK2). This antibody is labeled with Biotin.

Kallikrein 2 (KLK2) Polyclonal Antibody (Human, Rat), Cy3
4-PAD108Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK2 (Pro19~Pro261) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Kallikrein 2 (KLK2). This antibody is labeled with Cy3.

Kallikrein 2 (KLK2) Polyclonal Antibody (Human, Rat), FITC
4-PAD108Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK2 (Pro19~Pro261) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Kallikrein 2 (KLK2). This antibody is labeled with FITC.

Kallikrein 2 (KLK2) Polyclonal Antibody (Human, Rat), HRP
4-PAD108Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK2 (Pro19~Pro261) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Kallikrein 2 (KLK2). This antibody is labeled with HRP.

Kallikrein 2 (KLK2) Polyclonal Antibody (Human, Rat), PE
4-PAD108Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK2 (Pro19~Pro261) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Kallikrein 2 (KLK2). This antibody is labeled with PE.

Kallikrein 2 (KLK2) Monoclonal Antibody (Human), APC-Cy7
4-MAD108Hu21-APC-Cy7	Cloud-Clone	EUR 596.00 EUR 6790.00 EUR 1795.00 EUR 796.00 EUR 329.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Pro19~Pro261 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Kallikrein 2 (KLK2). This antibody is labeled with APC-Cy7.

Polyclonal Kallikrein 2 (KLK2) Antibody (C-term)
APR05742G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Kallikrein 2 (KLK2) (C-term). This antibody is tested and proven to work in the following applications:

Kallikrein 2 (KLK2) Polyclonal Antibody (Human, Rat), APC-Cy7
4-PAD108Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK2 (Pro19~Pro261) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Kallikrein 2 (KLK2). This antibody is labeled with APC-Cy7.

KLK2 ELISA KIT|Human
EF005749	Lifescience Market	96 Tests	EUR 689

Human Kallikrein-2 (KLK2) AssayLite Antibody (FITC, RPE, APC, PerCP Conjugate)
32231-05181	AssayPro	1 x 75 ug, 3 x 30 ug	EUR 585

Human Kallikrein 2 ELISA kit
E01K0077-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 2 ELISA kit
E01K0077-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 2 ELISA kit
E01K0077-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 2 ELISA Kit
ELA-E0278h	Lifescience Market	96 Tests	EUR 824

KLK2 ELISA Kit (Human) (OKAN05406)
OKAN05406	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a member of the grandular kallikrein protein family. Kallikreins are a subgroup of serine proteases that are clustered on chromosome 19. Members of this family are involved in a diverse array of biological functions. The protein encoded by this gene is a highly active trypsin-like serine protease that selectively cleaves at arginine residues. This protein is primarily expressed in prostatic tissue and is responsible for cleaving pro-prostate-specific antigen into its enzymatically active form. This gene is highly expressed in prostate tumor cells and may be a prognostic maker for prostate cancer risk. Alternate splicing results in both coding and non-coding transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.059 ng/mL

KLK2 ELISA Kit (Human) (OKCD08389)
OKCD08389	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Glandular kallikreins cleave Met-Lys and Arg-Ser bonds in kininogen to release Lys-bradykinin.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.056 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human Kallikrein 2(hK 2) ELISA Kit
CSB-E13094h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Kallikrein 2 (hK 2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Kallikrein 2(hK 2) ELISA Kit
1-CSB-E13094h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Kallikrein 2(hK 2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Goat Kallikrein 2 ELISA kit
E06K0077-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Kallikrein 2 ELISA kit
E06K0077-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Kallikrein 2 ELISA kit
E06K0077-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Kallikrein 2 ELISA kit
E02K0077-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Kallikrein 2 ELISA kit
E02K0077-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Kallikrein 2 ELISA kit
E02K0077-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 2 ELISA kit
E03K0077-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 2 ELISA kit
E03K0077-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 2 ELISA kit
E03K0077-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Kallikrein 2 ELISA kit
E04K0077-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Kallikrein 2 ELISA kit
E04K0077-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Kallikrein 2 ELISA kit
E04K0077-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Kallikrein 2 ELISA Kit
ELA-E0278m	Lifescience Market	96 Tests	EUR 865

Rat Kallikrein 2 ELISA Kit
ELA-E0278r	Lifescience Market	96 Tests	EUR 886

Dog Kallikrein 2 ELISA kit
E08K0077-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Kallikrein 2 ELISA kit
E08K0077-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Kallikrein 2 ELISA kit
E08K0077-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Kallikrein 2 ELISA kit
E07K0077-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Kallikrein 2 ELISA kit
E07K0077-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Kallikrein 2 ELISA kit
E07K0077-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Kallikrein 2 ELISA kit
E09K0077-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Kallikrein 2 ELISA kit
E09K0077-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Kallikrein 2 ELISA kit
E09K0077-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tonin (KLK2) ELISA Kit
abx512456-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Anti-Kallikrein 6/KLK6 Antibody
A01882-2	BosterBio	100ug/vial	EUR 294

KLK2 ELISA Kit (Human) : 96 Wells (OKEH00359)
OKEH00359	Aviva Systems Biology	96 Wells	EUR 740
Description: Description of target: Glandular kallikreins cleave Met-Lys and Arg-Ser bonds in kininogen to release Lys-bradykinin.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.038 ng/mL

KLK2 siRNA
20-abx921838	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

KLK2 siRNA
20-abx921839	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

KLK2 antibody
70R-3860	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal KLK2 antibody raised against the middle region of KLK2

KLK2 Antibody
ABD7136	Lifescience Market	100 ug	EUR 438

KLK2 Antibody
36940-100ul	SAB	100ul	EUR 252

KLK2 antibody
38527-100ul	SAB	100ul	EUR 252

KLK2 antibody
70R-14163	Fitzgerald	100 ug	EUR 322
Description: Affinity purified Rabbit polyclonal KLK2 antibody

KLK2 antibody
70R-14341	Fitzgerald	100 ug	EUR 565
Description: Goat polyclonal KLK2 antibody

KLK2 Antibody
DF7136	Affbiotech	200ul	EUR 304
Description: KLK2 Antibody detects endogenous levels of total KLK2.

KLK2 Antibody
1-CSB-PA012453LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KLK2. Recognizes KLK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

KLK2 Antibody
1-CSB-PA085005	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KLK2. Recognizes KLK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:100-1:300

KLK2 Antibody
1-CSB-PA039286	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KLK2. Recognizes KLK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

Guinea pig Kallikrein 2 ELISA kit
E05K0077-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Kallikrein 2 ELISA kit
E05K0077-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Kallikrein 2 ELISA kit
E05K0077-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

KLK2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1159603	ABM	1.0 ug DNA	EUR 154

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Kallikrein 2 Protein
80-1598	Fitzgerald	10 ug	EUR 354
Description: Recombinant Human Kallikrein 2 Protein

Kallikrein-2, Human Recombinant
P1579-100	Biovision	100 µg	EUR 510

Kallikrein-2, Human Recombinant
P1579-20	Biovision	20 µg	EUR 156

Human KLK2 shRNA Plasmid
20-abx952586	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

KLK2 Recombinant Protein (Human)
RP017239	ABM	100 ug	Ask for price

Human KalliKrein 1 ELISA kit
E01K0026-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human KalliKrein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human KalliKrein 1 ELISA kit
E01K0026-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human KalliKrein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human KalliKrein 1 ELISA kit
E01K0026-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human KalliKrein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 10 ELISA kit
E01K0070-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 10 ELISA kit
E01K0070-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 10 ELISA kit
E01K0070-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 11 ELISA kit
E01K0072-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 11 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 11 ELISA kit
E01K0072-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 11 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 11 ELISA kit
E01K0072-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 11 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 6 ELISA kit
E01K0073-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 6 ELISA kit
E01K0073-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 6 ELISA kit
E01K0073-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 7 ELISA kit
E01K0074-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 7 ELISA kit
E01K0074-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 7 ELISA kit
E01K0074-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 8 ELISA kit
E01K0075-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 8 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 8 ELISA kit
E01K0075-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 8 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 8 ELISA kit
E01K0075-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 8 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 3 ELISA kit
E01K0078-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 3 ELISA kit
E01K0078-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 3 ELISA kit
E01K0078-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 5 ELISA kit
E01K0079-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 5 ELISA kit
E01K0079-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 5 ELISA kit
E01K0079-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 9 ELISA Kit
ELA-E0408h	Lifescience Market	96 Tests	EUR 824

Human Kallikrein 11 ELISA Kit
ELA-E0669h	Lifescience Market	96 Tests	EUR 824

Human Kallikrein 8 ELISA Kit
ELA-E0690h	Lifescience Market	96 Tests	EUR 824

Human Kallikrein 6 ELISA Kit
ELA-E0691h	Lifescience Market	96 Tests	EUR 824

Human Kallikrein 10 ELISA Kit
ELA-E0697h	Lifescience Market	96 Tests	EUR 824

Human Kallikrein 1 ELISA Kit
ELA-E0967h	Lifescience Market	96 Tests	EUR 824

Human Kallikrein 7 ELISA Kit
ELA-E1910h	Lifescience Market	96 Tests	EUR 824

Human Kallikrein 3 ELISA Kit
ELA-E8720h	Lifescience Market	96 Tests	EUR 824

Human Kallikrein 6 ELISA Kit
ELA-E8916h	Lifescience Market	96 Tests	EUR 824

Kallikrein 11 ELISA KIT|Human
EF010428	Lifescience Market	96 Tests	EUR 689

Human Kallikrein 3 ELISA Kit
55R-1761	Fitzgerald	1 kit	EUR 651
Description: ELISA kit for detection of Kallikrein 3 in the research laboratory

Human Kallikrein-6 ELISA Kit
LF-EK50923	Abfrontier	1×96T	EUR 648

Human Kallikrein 14 ELISA Kit
LF-EK50970	Abfrontier	1×96T	EUR 648

Kallikrein-2 (Recombinant)
20-abx073401	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

anti-Kallikrein 2
YF-PA12848	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to Kallikrein 2

anti-Kallikrein 2
YF-PA12849	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Kallikrein 2

anti-Kallikrein 2
YF-PA12850	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to Kallikrein 2

anti-Kallikrein 2
YF-PA12851	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to Kallikrein 2

KLK2 Conjugated Antibody
C36940	SAB	100ul	EUR 397

KLK2 Conjugated Antibody
C38527	SAB	100ul	EUR 397

KLK2 cloning plasmid
CSB-CL012453HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 786 Sequence: atgtgggacctggttctctccatcgccttgtctgtggggtgcactggtgccgtgcccctcatccagtctcggattgtgggaggctgggagtgtgagaagcattcccaaccctggcaggtggctgtgtacagtcatggatgggcacactgtgggggtgtcctggtgcacccccagtg Show more
Description: A cloning plasmid for the KLK2 gene.

KLK2 Rabbit pAb
A12268-100ul	Abclonal	100 ul	EUR 308

KLK2 Rabbit pAb
A12268-200ul	Abclonal	200 ul	EUR 459

KLK2 Rabbit pAb
A12268-20ul	Abclonal	20 ul	EUR 183

KLK2 Rabbit pAb
A12268-50ul	Abclonal	50 ul	EUR 223

KLK2 Rabbit pAb
A2990-100ul	Abclonal	100 ul	EUR 308

KLK2 Rabbit pAb
A2990-200ul	Abclonal	200 ul	EUR 459

KLK2 Rabbit pAb
A2990-20ul	Abclonal	20 ul	EUR 183

KLK2 Rabbit pAb
A2990-50ul	Abclonal	50 ul	EUR 223

KLK2 Blocking Peptide
33R-4419	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KLK2 antibody, catalog no. 70R-3860

KLK2 Blocking Peptide
DF7136-BP	Affbiotech	1mg	EUR 195

Anti-KLK2 antibody
STJ71120	St John's Laboratory	100 µg	EUR 359

Anti-KLK2 antibody
STJ24331	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the grandular kallikrein protein family. Kallikreins are a subgroup of serine proteases that are clustered on chromosome 19. Members of this family are involved in a diverse array of biological functions. The protein encoded by this gene is a highly active trypsin-like serine protease that selectively cleaves at arginine residues. This protein is primarily expressed in prostatic tissue and is responsible for cleaving pro-prostate-specific antigen into its enzymatically active form. This gene is highly expressed in prostate tumor cells and may be a prognostic maker for prostate cancer risk. Alternate splicing results in both coding and non-coding transcript variants.

Human KLK2(Kallikrein 2) ELISA Kit