Human AXIN2(Axis Inhibition Protein 2) ELISA Kit

Human AXIN2(Axis Inhibition Protein 2) ELISA Kit

To Order: Contact us

Human Axis Inhibition Protein 2 (AXIN2) ELISA Kit
RDR-AXIN2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Axis Inhibition Protein 2 (AXIN2) ELISA Kit
RDR-AXIN2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Axis Inhibition Protein 2 (AXIN2) ELISA Kit
RD-AXIN2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Axis Inhibition Protein 2 (AXIN2) ELISA Kit
RD-AXIN2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Axis Inhibition Protein 2 (AXIN2) ELISA Kit
20-abx150774	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Axis Inhibition Protein 2 (AXIN2) ELISA Kit
abx251855-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Axis Inhibition Protein 2 (AXIN2) ELISA Kit
abx572388-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Axis Inhibition Protein 2(AXIN2)ELISA Kit
QY-E05124	Qayee Biotechnology	96T	EUR 361

Human Axis Inhibition Protein 2 (AXIN2) ELISA Kit
SEC192Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Axis Inhibition Protein 2 (AXIN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Axis Inhibition Protein 2 (AXIN2) in Tissue homogenates, cell lysates and other biological fluids.

Human Axis Inhibition Protein 2 (AXIN2) ELISA Kit
SEC192Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Axis Inhibition Protein 2 (AXIN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Axis Inhibition Protein 2 (AXIN2) in Tissue homogenates, cell lysates and other biological fluids.

Human Axis Inhibition Protein 2 (AXIN2) ELISA Kit
SEC192Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Axis Inhibition Protein 2 (AXIN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Axis Inhibition Protein 2 (AXIN2) in Tissue homogenates, cell lysates and other biological fluids.

Human Axis Inhibition Protein 2 (AXIN2) ELISA Kit
SEC192Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Axis Inhibition Protein 2 (AXIN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Axis Inhibition Protein 2 (AXIN2) in Tissue homogenates, cell lysates and other biological fluids.

Human Axis Inhibition Protein 2 (AXIN2) ELISA Kit
4-SEC192Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Axis Inhibition Protein 2 elisa. Alternative names of the recognized antigen: Axil Conductin Axin Related Protein Axin-like protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Axis Inhibition Protein 2 (AXIN2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Axis Inhibition Protein 2 (AXIN2) Antibody
20-abx214014	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Axis Inhibition Protein 2 (AXIN2) Antibody
20-abx214015	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Axis Inhibition Protein 2 (AXIN2) Antibody
20-abx102593	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Axis Inhibition Protein 2 (AXIN2) Antibody
abx122550-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Axis Inhibition Protein 2 (AXIN2) Antibody
20-abx141689	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Axis Inhibition Protein 2 (AXIN2) Antibody
20-abx171379	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Axis Inhibition Protein 2 (AXIN2) Antibody
abx032512-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Axis Inhibition Protein 2 (AXIN2) Antibody
abx032512-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Axis Inhibition Protein 2 (AXIN2) Antibody
20-abx333956	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Axis Inhibition Protein 2 (AXIN2) Antibody
abx230753-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Axis Inhibition Protein 2 (AXIN2) Antibody
20-abx001955	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Recombinant Axis Inhibition Protein 2 (AXIN2)
4-RPC192Hu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9Y2T1 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 32.7kDa Isoelectric Point: Inquire
Description: Recombinant Human Axis Inhibition Protein 2 expressed in: E.coli

Human Axis Inhibition Protein 2 (AXIN2) Protein
20-abx065489	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Mouse Axis Inhibition Protein 2 (AXIN2) ELISA Kit
abx255204-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Rat Axis Inhibition Protein 2 (AXIN2) ELISA Kit
abx256721-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Pig Axis Inhibition Protein 2 (AXIN2) ELISA Kit
abx361014-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Axis Inhibition Protein 2 (AXIN2) ELISA Kit
abx363215-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Axis Inhibition Protein 2 (AXIN2) ELISA Kit
abx356773-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Axis Inhibition Protein 2 (AXIN2) ELISA Kit
abx359156-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Axis Inhibition Protein 2 (AXIN2) ELISA Kit
abx521208-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Mouse AXIN2(Axis Inhibition Protein 2) ELISA Kit
EM0862	FN Test	96T	EUR 524.1
Detection range: 15.625-1000 pg/ml Uniprot ID: O88566 Alias: AXIN2/Conductin/Axin-like protein(Axil)/Axis inhibition protein 2
Description: Method of detection: Double Antibody, Sandwich ELISA ;Reacts with: Mus ;Sensitivity: 9.375pg/ml

Rat AXIN2(Axis Inhibition Protein 2) ELISA Kit
ER0752	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: O70240 Alias: AXIN2/Axis Inhibitor 2/AXIL/Conductin/MGC10366/MGC126582/Axil/axin 2/axin-2/Axin-like protein/Axis inhibition protein 2/conductin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.188 ng/ml

Human Axis Inhibition Protein 2 (AXIN2) CLIA Kit
abx195220-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Axis Inhibition Protein 2 (AXIN2) CLIA Kit
20-abx493530	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human AXIN2 (Axis Inhibition Protein 2)
E-EL-H0538	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's AXIN2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human AXIN2. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human AXIN2 (Axis Inhibition Protein 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human AXIN2 (Axis Inhibition Protein 2)
ELK3070	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Axis Inhibition Protein 2 (AXIN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Show more
Description: A sandwich ELISA kit for detection of Axis Inhibition Protein 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Axis Inhibition Protein 2 (AXIN2) Antibody (HRP)
20-abx334785	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Axis Inhibition Protein 2 (AXIN2) Antibody (FITC)
20-abx334786	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Axis Inhibition Protein 2 (AXIN2) Antibody (Biotin)
20-abx334787	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mouse Axis Inhibition Protein 2 (AXIN2) CLIA Kit
abx195221-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

ELISA kit for Mouse AXIN2 (Axis Inhibition Protein 2)
E-EL-M0167	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's AXIN2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse AXIN2. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse AXIN2 (Axis Inhibition Protein 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat AXIN2 (Axis Inhibition Protein 2)
E-EL-R0085	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's AXIN2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat AXIN2. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat AXIN2 (Axis Inhibition Protein 2) in samples from Serum, Plasma, Cell supernatant

Guinea pig Axis Inhibition Protein 2 (AXIN2) ELISA Kit
abx357616-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Axis Inhibition Protein 2 (AXIN2) Polyclonal Antibody (Human)
4-PAC192Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN2 (Pro350~Lys631) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Axis Inhibition Protein 2 (AXIN2)

CLIA kit for Human AXIN2 (Axis Inhibition Protein 2)
E-CL-H0429	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's AXIN2 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human AXIN2 . Standards or samples are added to the micro CLIA plate wells and combined with th Show more
Description: A sandwich CLIA kit for quantitative measurement of Human AXIN2 (Axis Inhibition Protein 2) in samples from Serum, Plasma, Cell supernatant

AXIN2 ELISA Kit| Rat Axis Inhibition Protein 2 ELISA Kit
EF017552	Lifescience Market	96 Tests	EUR 689

AXIN2 ELISA Kit| Mouse Axis Inhibition Protein 2 ELISA Kit
EF013459	Lifescience Market	96 Tests	EUR 689

CLIA kit for Mouse AXIN2 (Axis Inhibition Protein 2)
E-CL-M0125	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's AXIN2 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse AXIN2 . Standards or samples are added to the micro CLIA plate wells and combined with th Show more
Description: A sandwich CLIA kit for quantitative measurement of Mouse AXIN2 (Axis Inhibition Protein 2) in samples from Serum, Plasma, Cell supernatant

Axis Inhibition Protein 2 (AXIN2) Polyclonal Antibody (Human), APC
4-PAC192Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN2 (Pro350~Lys631) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Axis Inhibition Protein 2 (AXIN2). This antibody is labeled with APC.

Axis Inhibition Protein 2 (AXIN2) Polyclonal Antibody (Human), Biotinylated
4-PAC192Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN2 (Pro350~Lys631) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Axis Inhibition Protein 2 (AXIN2). This antibody is labeled with Biotin.

Axis Inhibition Protein 2 (AXIN2) Polyclonal Antibody (Human), Cy3
4-PAC192Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN2 (Pro350~Lys631) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Axis Inhibition Protein 2 (AXIN2). This antibody is labeled with Cy3.

Axis Inhibition Protein 2 (AXIN2) Polyclonal Antibody (Human), FITC
4-PAC192Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN2 (Pro350~Lys631) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Axis Inhibition Protein 2 (AXIN2). This antibody is labeled with FITC.

Axis Inhibition Protein 2 (AXIN2) Polyclonal Antibody (Human), HRP
4-PAC192Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN2 (Pro350~Lys631) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Axis Inhibition Protein 2 (AXIN2). This antibody is labeled with HRP.

Axis Inhibition Protein 2 (AXIN2) Polyclonal Antibody (Human), PE
4-PAC192Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN2 (Pro350~Lys631) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Axis Inhibition Protein 2 (AXIN2). This antibody is labeled with PE.

Axis Inhibition Protein 2 (AXIN2) Polyclonal Antibody (Human), APC-Cy7
4-PAC192Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN2 (Pro350~Lys631) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Axis Inhibition Protein 2 (AXIN2). This antibody is labeled with APC-Cy7.

Human Axis Inhibition Protein 2 ELISA kit
E01A0305-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Axis Inhibition Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Axis Inhibition Protein 2 ELISA kit
E01A0305-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Axis Inhibition Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Axis Inhibition Protein ELISA kit
E01A0304-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Axis Inhibition Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Axis Inhibition Protein ELISA kit
E01A0304-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Axis Inhibition Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Axis Inhibition Protein 2 ELISA kit
E03A0305-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Axis Inhibition Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Axis Inhibition Protein 2 ELISA kit
E03A0305-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Axis Inhibition Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Axis Inhibition Protein 2 ELISA kit
E03A0305-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Axis Inhibition Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Axis Inhibition Protein 2 ELISA kit
E04A0305-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Axis Inhibition Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Axis Inhibition Protein 2 ELISA kit
E04A0305-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Axis Inhibition Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Axis Inhibition Protein 2 ELISA kit
E04A0305-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Axis Inhibition Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Axis Inhibition Protein 2 ELISA kit
E02A0305-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Axis Inhibition Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Axis Inhibition Protein 2 ELISA kit
E02A0305-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Axis Inhibition Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Axis Inhibition Protein 2 ELISA kit
E02A0305-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Axis Inhibition Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Axis Inhibition Protein 2 ELISA kit
E06A0305-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Axis Inhibition Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Axis Inhibition Protein 2 ELISA kit
E06A0305-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Axis Inhibition Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Axis Inhibition Protein 2 ELISA kit
E06A0305-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Axis Inhibition Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Axis Inhibition Protein 2 ELISA kit
E09A0305-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Axis Inhibition Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Axis Inhibition Protein 2 ELISA kit
E09A0305-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Axis Inhibition Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Axis Inhibition Protein 2 ELISA kit
E09A0305-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Axis Inhibition Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Axis Inhibition Protein 2 ELISA kit
E08A0305-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Axis Inhibition Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Axis Inhibition Protein 2 ELISA kit
E08A0305-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Axis Inhibition Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Axis Inhibition Protein 2 ELISA kit
E08A0305-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Axis Inhibition Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Axis Inhibition Protein 2 ELISA kit
E07A0305-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Axis Inhibition Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Axis Inhibition Protein 2 ELISA kit
E07A0305-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Axis Inhibition Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Axis Inhibition Protein 2 ELISA kit
E07A0305-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Axis Inhibition Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Axis Inhibition Protein ELISA kit
E03A0304-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Axis Inhibition Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Axis Inhibition Protein ELISA kit
E03A0304-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Axis Inhibition Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Axis Inhibition Protein ELISA kit
E03A0304-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Axis Inhibition Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Axis Inhibition Protein ELISA kit
E04A0304-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Axis Inhibition Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Axis Inhibition Protein ELISA kit
E04A0304-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Axis Inhibition Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Axis Inhibition Protein ELISA kit
E04A0304-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Axis Inhibition Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Axis Inhibition Protein ELISA kit
E02A0304-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Axis Inhibition Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Axis Inhibition Protein ELISA kit
E02A0304-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Axis Inhibition Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Axis Inhibition Protein ELISA kit
E02A0304-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Axis Inhibition Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Axis Inhibition Protein ELISA kit
E06A0304-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Axis Inhibition Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Axis Inhibition Protein ELISA kit
E06A0304-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Axis Inhibition Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Axis Inhibition Protein ELISA kit
E06A0304-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Axis Inhibition Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Axis Inhibition Protein ELISA kit
E09A0304-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Axis Inhibition Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Axis Inhibition Protein ELISA kit
E09A0304-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Axis Inhibition Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Axis Inhibition Protein ELISA kit
E09A0304-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Axis Inhibition Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Axis Inhibition Protein ELISA kit
E08A0304-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Axis Inhibition Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Axis Inhibition Protein ELISA kit
E08A0304-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Axis Inhibition Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Axis Inhibition Protein ELISA kit
E08A0304-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Axis Inhibition Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Axis Inhibition Protein ELISA kit
E07A0304-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Axis Inhibition Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Axis Inhibition Protein ELISA kit
E07A0304-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Axis Inhibition Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Axis Inhibition Protein ELISA kit
E07A0304-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Axis Inhibition Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Axis Inhibition Protein 2 ELISA kit
E05A0305-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Axis Inhibition Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Axis Inhibition Protein 2 ELISA kit
E05A0305-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Axis Inhibition Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Axis Inhibition Protein 2 ELISA kit
E05A0305-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Axis Inhibition Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Axis Inhibition Protein ELISA kit
E05A0304-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Axis Inhibition Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Axis Inhibition Protein ELISA kit
E05A0304-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Axis Inhibition Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Axis Inhibition Protein ELISA kit
E05A0304-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Axis Inhibition Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Axis Inhibition Protein (AXIN) Protein
20-abx065488	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Axis Inhibition Protein 1 (AXIN1) ELISA Kit
abx251866-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Axis Inhibition Protein (AXIN) Antibody
20-abx175532	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Axis Inhibition Protein (AXIN) Antibody
20-abx102315	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Axis Inhibition Protein (AXIN) Antibody
20-abx102316	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Axis Inhibition Protein (AXIN) Antibody
20-abx130208	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Recombinant Axis Inhibition Protein (AXIN)
4-RPC191Hu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O15169 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 27.6kDa Isoelectric Point: 8.8
Description: Recombinant Human Axis Inhibition Protein expressed in: E.coli

Recombinant Axis Inhibition Protein (AXIN)
4-RPC191Mu01	Cloud-Clone	EUR 479.90 EUR 232.00 EUR 1524.64 EUR 574.88 EUR 1049.76 EUR 384.00 EUR 3661.60	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O35625 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 27.2kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Axis Inhibition Protein expressed in: E.coli

Recombinant Axis Inhibition Protein (AXIN)
4-RPC191Ra01	Cloud-Clone	EUR 528.29 EUR 244.00 EUR 1706.08 EUR 635.36 EUR 1170.72 EUR 416.00 EUR 4115.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O35625 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 27.4kDa Isoelectric Point: 9.3
Description: Recombinant Rat Axis Inhibition Protein expressed in: E.coli

Chicken Axis Inhibition Protein 1 (AXIN1) ELISA Kit
abx521253-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Axis Inhibition Protein 1 (AXIN1) ELISA Kit
abx521255-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Axis Inhibition Protein 1 (AXIN1) ELISA Kit
abx521256-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Axis Inhibition Protein (AXIN) Protein
20-abx165956	Abbexa	EUR 732.00 EUR 286.00 EUR 2291.00 EUR 871.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Axis Inhibition Protein (AXIN) Protein
20-abx065487	Abbexa	EUR 676.00 EUR 272.00 EUR 2054.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody
20-abx007811	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody
20-abx126838	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody
20-abx137362	Abbexa	EUR 704.00 EUR 328.00 EUR 230.00	100 ug 20 ug 5 ug
Shipped within 5-10 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody
20-abx241358	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody
20-abx241359	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody
20-abx315414	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody
abx448563-100ug	Abbexa	100 ug	EUR 523
Shipped within 5-12 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody
abx431120-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody
abx230752-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Axis Inhibition Protein (AXIN) Polyclonal Antibody (Human)
4-PAC191Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN (Ser653~Asp862) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Axis Inhibition Protein (AXIN)

Axis Inhibition Protein (AXIN) Polyclonal Antibody (Human), APC
4-PAC191Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN (Ser653~Asp862) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Axis Inhibition Protein (AXIN). This antibody is labeled with APC.

Axis Inhibition Protein (AXIN) Polyclonal Antibody (Human), Biotinylated
4-PAC191Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN (Ser653~Asp862) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Axis Inhibition Protein (AXIN). This antibody is labeled with Biotin.

Axis Inhibition Protein (AXIN) Polyclonal Antibody (Human), Cy3
4-PAC191Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN (Ser653~Asp862) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Axis Inhibition Protein (AXIN). This antibody is labeled with Cy3.

Axis Inhibition Protein (AXIN) Polyclonal Antibody (Human), FITC
4-PAC191Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN (Ser653~Asp862) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Axis Inhibition Protein (AXIN). This antibody is labeled with FITC.

Axis Inhibition Protein (AXIN) Polyclonal Antibody (Human), HRP
4-PAC191Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN (Ser653~Asp862) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Axis Inhibition Protein (AXIN). This antibody is labeled with HRP.

Axis Inhibition Protein (AXIN) Polyclonal Antibody (Human), PE
4-PAC191Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN (Ser653~Asp862) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Axis Inhibition Protein (AXIN). This antibody is labeled with PE.

Axis Inhibition Protein 1 (AXIN1) Antibody (HRP)
20-abx315415	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (FITC)
20-abx315416	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (Biotin)
20-abx315417	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (ALP)
abx446475-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (APC)
abx446476-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (PerCP)
abx446481-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (RPE)
abx446482-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (Streptavidin)
abx446483-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Axis Inhibition Protein (AXIN) Polyclonal Antibody (Mouse)
4-PAC191Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN (Lys654~Asp863) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Axis Inhibition Protein (AXIN)

Axis Inhibition Protein (AXIN) Polyclonal Antibody (Rat)
4-PAC191Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN (Thr618~Asp827) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Axis Inhibition Protein (AXIN)

Axis Inhibition Protein (AXIN) Polyclonal Antibody (Human), APC-Cy7
4-PAC191Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN (Ser653~Asp862) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Axis Inhibition Protein (AXIN). This antibody is labeled with APC-Cy7.

Axis Inhibition Protein 1 (AXIN1) Antibody (ATTO 390)
abx446467-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (ATTO 488)
abx446468-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (ATTO 565)
abx446469-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (ATTO 594)
abx446470-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (ATTO 633)
abx446471-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (ATTO 655)
abx446472-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (ATTO 680)
abx446473-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (ATTO 700)
abx446474-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Axis Inhibition Protein (AXIN) Polyclonal Antibody (Mouse), APC
4-PAC191Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN (Lys654~Asp863) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Axis Inhibition Protein (AXIN). This antibody is labeled with APC.

Axis Inhibition Protein (AXIN) Polyclonal Antibody (Mouse), Biotinylated
4-PAC191Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN (Lys654~Asp863) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Axis Inhibition Protein (AXIN). This antibody is labeled with Biotin.

Axis Inhibition Protein (AXIN) Polyclonal Antibody (Mouse), Cy3
4-PAC191Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN (Lys654~Asp863) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Axis Inhibition Protein (AXIN). This antibody is labeled with Cy3.

Axis Inhibition Protein (AXIN) Polyclonal Antibody (Mouse), FITC
4-PAC191Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN (Lys654~Asp863) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Axis Inhibition Protein (AXIN). This antibody is labeled with FITC.

Axis Inhibition Protein (AXIN) Polyclonal Antibody (Mouse), HRP
4-PAC191Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN (Lys654~Asp863) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Axis Inhibition Protein (AXIN). This antibody is labeled with HRP.

Axis Inhibition Protein (AXIN) Polyclonal Antibody (Mouse), PE
4-PAC191Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN (Lys654~Asp863) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Axis Inhibition Protein (AXIN). This antibody is labeled with PE.

Axis Inhibition Protein (AXIN) Polyclonal Antibody (Rat), APC
4-PAC191Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN (Thr618~Asp827) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Axis Inhibition Protein (AXIN). This antibody is labeled with APC.

Axis Inhibition Protein (AXIN) Polyclonal Antibody (Rat), Biotinylated
4-PAC191Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN (Thr618~Asp827) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Axis Inhibition Protein (AXIN). This antibody is labeled with Biotin.

Axis Inhibition Protein (AXIN) Polyclonal Antibody (Rat), Cy3
4-PAC191Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN (Thr618~Asp827) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Axis Inhibition Protein (AXIN). This antibody is labeled with Cy3.

Axis Inhibition Protein (AXIN) Polyclonal Antibody (Rat), FITC
4-PAC191Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN (Thr618~Asp827) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Axis Inhibition Protein (AXIN). This antibody is labeled with FITC.

Axis Inhibition Protein (AXIN) Polyclonal Antibody (Rat), HRP
4-PAC191Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN (Thr618~Asp827) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Axis Inhibition Protein (AXIN). This antibody is labeled with HRP.

Axis Inhibition Protein (AXIN) Polyclonal Antibody (Rat), PE
4-PAC191Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN (Thr618~Asp827) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Axis Inhibition Protein (AXIN). This antibody is labeled with PE.

Axis Inhibition Protein 1 (AXIN1) Antibody (PE/ATTO 594)
abx446480-100ug	Abbexa	100 ug	EUR 592
Shipped within 5-12 working days.

Axis Inhibition Protein (AXIN) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC191Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN (Lys654~Asp863) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Axis Inhibition Protein (AXIN). This antibody is labeled with APC-Cy7.

Axis Inhibition Protein (AXIN) Polyclonal Antibody (Rat), APC-Cy7
4-PAC191Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AXIN (Thr618~Asp827) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Axis Inhibition Protein (AXIN). This antibody is labeled with APC-Cy7.

Axin2/ Rat Axin2 ELISA Kit
ELI-24454r	Lifescience Market	96 Tests	EUR 886

Human AXIN2/ Axin-2 ELISA Kit
E0241Hu	Sunlong	1 Kit	EUR 605

Human AXIN2(Axin-2) ELISA Kit
EH2487	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: Q9Y2T1 Alias: AXIN2/Axis Inhibitor 2/AXIL/Conductin/MGC10366/MGC126582/Axil/axin 2/axin-2/Axin-like protein/Axis inhibition protein 2/conductin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Axin- 2, AXIN2 ELISA KIT
ELI-11471h	Lifescience Market	96 Tests	EUR 824

Human AXIN2 ELISA Kit
EHA0312	Abclonal	96Tests	EUR 521

Human AXIN2 ELISA Kit
ELA-E9563h	Lifescience Market	96 Tests	EUR 824

AXIN2 ELISA KIT|Human
EF006521	Lifescience Market	96 Tests	EUR 689

Rat Axin2/ Axin-2 ELISA Kit
E0112Ra	Sunlong	1 Kit	EUR 646

Mouse Axin2/ Axin-2 ELISA Kit
E0153Mo	Sunlong	1 Kit	EUR 632

Mouse Axin- 2, Axin2 ELISA KIT
ELI-11429m	Lifescience Market	96 Tests	EUR 865

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

AXIN2 ELISA Kit (Human) (OKCD08039)
OKCD08039	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: The Axin-related protein, Axin2, presumably plays an important role in the regulation of the stability of beta-catenin in the Wnt signaling pathway, like its rodent homologs, mouse conductin/rat axil. In mouse, conductin organizes a multiprotein complex of APC (adenomatous polyposis of the colon), beta-catenin, glycogen synthase kinase 3-beta, and conductin, which leads to the degradation of beta-catenin. Apparently, the deregulation of beta-catenin is an important event in the genesis of a number of malignancies. The AXIN2 gene has been mapped to 17q23-q24, a region that shows frequent loss of heterozygosity in breast cancer, neuroblastoma, and other tumors. Mutations in this gene have been associated with colorectal cancer with defective mismatch repair.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.127ng/mL

Goat AXIN2 ELISA Kit
EGTA0312	Abclonal	96Tests	EUR 521

Canine AXIN2 ELISA Kit
ECA0312	Abclonal	96Tests	EUR 521

Anserini AXIN2 ELISA Kit
EAA0312	Abclonal	96Tests	EUR 521

Bovine AXIN2 ELISA Kit
EBA0312	Abclonal	96Tests	EUR 521

Mouse AXIN2 ELISA Kit
EMA0312	Abclonal	96Tests	EUR 521

Rat AXIN2 ELISA Kit
ERA0312	Abclonal	96Tests	EUR 521

Rabbit AXIN2 ELISA Kit
ERTA0312	Abclonal	96Tests	EUR 521

Porcine AXIN2 ELISA Kit
EPA0312	Abclonal	96Tests	EUR 521

Guinea Pig AXIN2 ELISA Kit
EGA0312	Abclonal	96Tests	EUR 521

AXIN2 ELISA Kit (Rat) (OKEH05944)
OKEH05944	Aviva Systems Biology	96 Wells	EUR 818
Description: Description of target: Inhibitor of the Wnt signaling pathway. Down-regulates beta-catenin. Probably facilitate the phosphorylation of beta-catenin and APC by GSK3B.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

AXIN2 ELISA Kit (Mouse) (OKEH04978)
OKEH04978	Aviva Systems Biology	96 Wells	EUR 727
Description: Description of target: Inhibitor of the Wnt signaling pathway. Down-regulates beta-catenin. Probably facilitate the phosphorylation of beta-catenin and APC by GSK3B.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

AXIN2 ELISA Kit (Human) : 96 Wells (OKEH01978)
OKEH01978	Aviva Systems Biology	96 Wells	EUR 727
Description: Description of target: The Axin-related protein, Axin2, presumably plays an important role in the regulation of the stability of beta-catenin in the Wnt signaling pathway, like its rodent homologs, mouse conductin/rat axil. In mouse, conductin organizes a multiprotein complex of APC (adenomatous polyposis of the colon), beta-catenin, glycogen synthase kinase 3-beta, and conductin, which leads to the degradation of beta-catenin. Apparently, the deregulation of beta-catenin is an important event in the genesis of a number of malignancies. The AXIN2 gene has been mapped to 17q23-q24, a region that shows frequent loss of heterozygosity in breast cancer, neuroblastoma, and other tumors. Mutations in this gene have been associated with colorectal cancer with defective mismatch repair. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL

AXIN2 Antibody
25253-100ul	SAB	100ul	EUR 390

AXIN2 Antibody
32685-100ul	SAB	100ul	EUR 252

Axin2 Antibody
49509-100ul	SAB	100ul	EUR 333

Axin2 Antibody
49509-50ul	SAB	50ul	EUR 239

AXIN2 Antibody
1-CSB-PA917071	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AXIN2. Recognizes AXIN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

AXIN2 Antibody
1-CSB-PA897472LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AXIN2. Recognizes AXIN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

AXIN2 Antibody
1-CSB-PA897472OA01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against AXIN2. Recognizes AXIN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

AXIN2 Antibody
DF6978	Affbiotech	200ul	EUR 304
Description: AXIN2 Antibody detects endogenous levels of total AXIN2.

AXIN2 Antibody
1-CSB-PA577711	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AXIN2. Recognizes AXIN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

AXIN2 siRNA
20-abx900564	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

AXIN2 siRNA
20-abx908737	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

AXIN2 siRNA
20-abx908738	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

AXIN2 Antibody
ABD6978	Lifescience Market	100 ug	EUR 438

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXIN2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0161303	ABM	1.0 ug DNA	EUR 154

Human AXIN2 shRNA Plasmid
20-abx955437	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

AXIN2 Rabbit pAb
A13373-100ul	Abclonal	100 ul	EUR 308

AXIN2 Rabbit pAb
A13373-200ul	Abclonal	200 ul	EUR 459

AXIN2 Rabbit pAb
A13373-20ul	Abclonal	20 ul	EUR 183

AXIN2 Rabbit pAb
A13373-50ul	Abclonal	50 ul	EUR 223

AXIN2 cloning plasmid
CSB-CL897472HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 483 Sequence: atgagtagcgctatgttggtgacttgcctcccggaccccagcagcagcttccgtgaggatgccccgcggcccccagtgccaggggaagaaggggagaccccaccgtgtcagccaggggtgggcaagggccaggtcaccaaacccatgcctgtctcttccaacaccaggcggaacga Show more
Description: A cloning plasmid for the AXIN2 gene.

AXIN2 Blocking Peptide
DF6978-BP	Affbiotech	1mg	EUR 195

Axin2 Conjugated Antibody
C49509	SAB	100ul	EUR 397

AXIN2 Conjugated Antibody
C32685	SAB	100ul