Human LACRT(Lacritin) ELISA Kit

Human LACRT(Lacritin) ELISA Kit

To Order: Contact us

Human Lacritin (LACRT) ELISA Kit

RD-LACRT-Hu-48Tests 48 Tests
EUR 521

Human Lacritin (LACRT) ELISA Kit

RD-LACRT-Hu-96Tests 96 Tests
EUR 723

Human Lacritin (LACRT) ELISA Kit

RDR-LACRT-Hu-48Tests 48 Tests
EUR 544

Human Lacritin (LACRT) ELISA Kit

RDR-LACRT-Hu-96Tests 96 Tests
EUR 756

Human Lacritin (LACRT) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Lacritin (LACRT) ELISA Kit

SEC576Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lacritin (LACRT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lacritin (LACRT) in saliva, tears and other biological fluids.

Human Lacritin (LACRT) ELISA Kit

SEC576Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lacritin (LACRT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lacritin (LACRT) in saliva, tears and other biological fluids.

Human Lacritin (LACRT) ELISA Kit

SEC576Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lacritin (LACRT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lacritin (LACRT) in saliva, tears and other biological fluids.

Human Lacritin (LACRT) ELISA Kit

SEC576Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lacritin (LACRT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lacritin (LACRT) in saliva, tears and other biological fluids.

Human Lacritin (LACRT) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Lacritin elisa. Alternative names of the recognized antigen: Extracellular glycoprotein lacritin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Lacritin (LACRT) in samples from saliva, tears and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Lacritin(LACRT)ELISA Kit

QY-E04824 96T
EUR 361

Lacritin (LACRT) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lacritin (LACRT) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Lacritin (LACRT) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Lacritin (LACRT)

  • EUR 519.33
  • EUR 242.00
  • EUR 1672.48
  • EUR 624.16
  • EUR 1148.32
  • EUR 410.00
  • EUR 4031.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9GZZ8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 44.7kDa
  • Isoelectric Point: 6.1
Description: Recombinant Human Lacritin expressed in: E.coli

Human Lacritin (LACRT) Protein

  • EUR 718.00
  • EUR 286.00
  • EUR 2249.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Lacritin (LACRT) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human LACRT (Lacritin)

ELK2907 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Lacritin (LACRT). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Lacritin (LACRT).
  • Show more
Description: A sandwich ELISA kit for detection of Lacritin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human LACRT (Extracellular glycoprotein lacritin) ELISA Kit

ELI-42678h 96 Tests
EUR 824

ELISA kit for Human Extracellular glycoprotein lacritin (LACRT)

KTE61868-48T 48T
EUR 332
  • Lacritin is a 12.3 kDa glycoprotein encoded in humans by the LACRT gene. Lacritin is a secreted protein found in tears and saliva. Lacritin also promotes tear secretion and proliferation of some epithelial cells. Lacritin is thus a prosecretory mitog
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Extracellular glycoprotein lacritin (LACRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Extracellular glycoprotein lacritin (LACRT)

KTE61868-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Lacritin is a 12.3 kDa glycoprotein encoded in humans by the LACRT gene. Lacritin is a secreted protein found in tears and saliva. Lacritin also promotes tear secretion and proliferation of some epithelial cells. Lacritin is thus a prosecretory mitog
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Extracellular glycoprotein lacritin (LACRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Extracellular glycoprotein lacritin (LACRT)

KTE61868-96T 96T
EUR 539
  • Lacritin is a 12.3 kDa glycoprotein encoded in humans by the LACRT gene. Lacritin is a secreted protein found in tears and saliva. Lacritin also promotes tear secretion and proliferation of some epithelial cells. Lacritin is thus a prosecretory mitog
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Extracellular glycoprotein lacritin (LACRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Extracellular Glycoprotein Lacritin (LACRT) Antibody

abx234671-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Lacritin (LACRT) Polyclonal Antibody (Human, Mouse)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LACRT (Glu20~Ala138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT)

Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LACRT (Glu20~Ala138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with APC.

Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LACRT (Glu20~Ala138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with Biotin.

Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LACRT (Glu20~Ala138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with Cy3.

Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LACRT (Glu20~Ala138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with FITC.

Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LACRT (Glu20~Ala138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with HRP.

Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LACRT (Glu20~Ala138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with PE.

Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LACRT (Glu20~Ala138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with APC-Cy7.


EF010606 96 Tests
EUR 689

LACRT ELISA Kit (Human) (OKCD00685)

OKCD00685 96 Wells
EUR 831
Description: Description of target: Modulates secretion by lacrimal acinar cells. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.63 ng/mL

LACRT ELISA Kit (Human) (OKDD00367)

OKDD00367 96 Wells
EUR 975
Description: Description of target: The protein encoded by this gene is highly expressed in the lacrimal glands and localized primarily to secretory granules and secretory fluid. It augments lacrimal acinar cell secretion, promotes ductal cell proliferation, and stimulates signaling through tyrosine phosphorylation and release of calcium.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.055 ng/mL


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LACRT antibody

70R-18201 50 ul
EUR 435
Description: Rabbit polyclonal LACRT antibody

LACRT Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against LACRT. Recognizes LACRT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

Human LACRT shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LACRT Recombinant Protein (Human)

RP017461 100 ug Ask for price

LACRT Recombinant Protein (Human)

RP017464 100 ug Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

anti- LACRT antibody

FNab04671 100µg
EUR 585
  • Immunogen: lacritin
  • Uniprot ID: Q9GZZ8
  • Gene ID: 90070
  • Research Area: Epigenetics, Signal Transduction
Description: Antibody raised against LACRT

LACRT Rabbit pAb

A14632-100ul 100 ul
EUR 308

LACRT Rabbit pAb

A14632-200ul 200 ul
EUR 459

LACRT Rabbit pAb

A14632-20ul 20 ul
EUR 183

LACRT Rabbit pAb

A14632-50ul 50 ul
EUR 223

LACRT Polyclonal Antibody

28656-100ul 100ul
EUR 252

LACRT Polyclonal Antibody

28656-50ul 50ul
EUR 187

LACRT cloning plasmid

CSB-CL887939HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 417
  • Sequence: atgaaatttaccactctcctcttcttggcagctgtagcaggggccctggtctatgctgaagatgcctcctctgactcgacgggtgctgatcctgcccaggaagctgggacctctaagcctaatgaagagatctcaggtccagcagaaccagcttcacccccagagacaaccacaac
  • Show more
Description: A cloning plasmid for the LACRT gene.

LACRT cloning plasmid

CSB-CL887939HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 417
  • Sequence: atgaaatttaccactctcctcttcttggcagctgtagcaggggccctggtctatgctgaagatgcctcctctgactcgacgggtgctgatcctgcccaggaagctgggacctctaagcctaatgaagagatctcaggtccagcagaaccagcttcacccccagagacaaccacaac
  • Show more
Description: A cloning plasmid for the LACRT gene.

Anti-LACRT antibody

PAab04671 100 ug
EUR 412

Anti-LACRT antibody

STJ116839 100 µl
EUR 277
Description: The protein encoded by this gene is highly expressed in the lacrimal glands and localized primarily to secretory granules and secretory fluid. It augments lacrimal acinar cell secretion, promotes ductal cell proliferation, and stimulates signaling through tyrosine phosphorylation and release of calcium.

LACRT ORF Vector (Human) (pORF)

ORF005821 1.0 ug DNA
EUR 95

LACRT ORF Vector (Human) (pORF)

ORF005822 1.0 ug DNA
EUR 95

LACRT Polyclonal Conjugated Antibody

C28656 100ul
EUR 397

LACRT sgRNA CRISPR Lentivector set (Human)

K1192801 3 x 1.0 ug
EUR 339

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

LACRT sgRNA CRISPR Lentivector (Human) (Target 1)

K1192802 1.0 ug DNA
EUR 154

LACRT sgRNA CRISPR Lentivector (Human) (Target 2)

K1192803 1.0 ug DNA
EUR 154

LACRT sgRNA CRISPR Lentivector (Human) (Target 3)

K1192804 1.0 ug DNA
EUR 154

LACRT Protein Vector (Human) (pPB-C-His)

PV023281 500 ng
EUR 329

LACRT Protein Vector (Human) (pPB-N-His)

PV023282 500 ng
EUR 329

LACRT Protein Vector (Human) (pPM-C-HA)

PV023283 500 ng
EUR 329

LACRT Protein Vector (Human) (pPM-C-His)

PV023284 500 ng
EUR 329

LACRT Protein Vector (Human) (pPB-C-His)

PV023285 500 ng
EUR 329

LACRT Protein Vector (Human) (pPB-N-His)

PV023286 500 ng
EUR 329

LACRT Protein Vector (Human) (pPM-C-HA)

PV023287 500 ng
EUR 329

LACRT Protein Vector (Human) (pPM-C-His)

PV023288 500 ng
EUR 329

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Human LACRT(Lacritin) ELISA Kit

Scroll to Top