Human ANXA6(Annexin A6) ELISA Kit

Human ANXA6(Annexin A6) ELISA Kit

To Order: Contact us

Human Annexin A6 (ANXA6) ELISA Kit
RDR-ANXA6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Annexin A6 (ANXA6) ELISA Kit
RD-ANXA6-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Annexin A6 (ANXA6) ELISA Kit
RD-ANXA6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Annexin A6 (ANXA6)
1-CSB-RP007944h	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 54.4 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Annexin A6(ANXA6),partial expressed in E.coli

Human ANXA6/ Annexin A6 ELISA Kit
E0163Hu	Sunlong	1 Kit	EUR 571

Human Annexin A6 (ANXA6) ELISA Kit
20-abx150672	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human ANXA6(Annexin A6) ELISA Kit
EH1625	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P08133 Alias: ANXA6/Annexin A6/Lipocortin VI/Chromobindin-20/Calphobindin-II/CPB-II/Annexin-6/p70/p68/Protein III/67 kDa calelectrin/Annexin VI/CBP68/Calelectrin/ANX6
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Annexin A6, ANXA6 ELISA KIT
ELI-04772h	Lifescience Market	96 Tests	EUR 824

Human Annexin A6 (ANXA6) ELISA Kit
abx570621-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Annexin A6(ANXA6)ELISA Kit
QY-E02146	Qayee Biotechnology	96T	EUR 361

Human Annexin A6 ELISA Kit (ANXA6)
RK00904	Abclonal	96 Tests	EUR 521

Human Annexin A6 (ANXA6) ELISA Kit
SEC345Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Annexin A6 (ANXA6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Annexin A6 (ANXA6) in tissue homogenates, cell lysates and other biological fluids.

Human Annexin A6 (ANXA6) ELISA Kit
SEC345Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Annexin A6 (ANXA6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Annexin A6 (ANXA6) in tissue homogenates, cell lysates and other biological fluids.

Human Annexin A6 (ANXA6) ELISA Kit
SEC345Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Annexin A6 (ANXA6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Annexin A6 (ANXA6) in tissue homogenates, cell lysates and other biological fluids.

Human Annexin A6 (ANXA6) ELISA Kit
SEC345Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Annexin A6 (ANXA6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Annexin A6 (ANXA6) in tissue homogenates, cell lysates and other biological fluids.

Human Annexin A6 (ANXA6) ELISA Kit
4-SEC345Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Annexin A6 elisa. Alternative names of the recognized antigen: ANX6 ANX-A6 CBP68 CPB-II Annexin VI 67 kDa calelectrin Calphobindin-II Chromobindin-20 Lipocortin VI
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Annexin A6 (ANXA6) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Annexin A6 (ANXA6) Antibody
20-abx009590	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody
20-abx004128	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody
20-abx214404	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody
20-abx214405	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody
20-abx100733	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Annexin A6 (ANXA6) Antibody
20-abx110999	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody
20-abx128840	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Annexin A6 (ANXA6) Antibody
20-abx109541	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody
abx122366-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody
abx159329-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody
20-abx171255	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Annexin A6 (ANXA6) Antibody
20-abx013020	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody
abx031169-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody
abx031169-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody
20-abx321529	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody
abx330476-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody
abx330534-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody
20-abx324814	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Recombinant Annexin A6 (ANXA6)
4-RPC345Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P08133 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 31.9kDa Isoelectric Point: 5.6
Description: Recombinant Human Annexin A6 expressed in: E.coli

Recombinant Annexin A6 (ANXA6)
4-RPC345Mu01	Cloud-Clone	EUR 517.54 EUR 241.00 EUR 1665.76 EUR 621.92 EUR 1143.84 EUR 409.00 EUR 4014.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P14824 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 32.3kDa Isoelectric Point: 7.2
Description: Recombinant Mouse Annexin A6 expressed in: E.coli

Chicken Annexin A6, ANXA6 ELISA KIT
ELI-04769c	Lifescience Market	96 Tests	EUR 928

Bovine Annexin A6, ANXA6 ELISA KIT
ELI-04770b	Lifescience Market	96 Tests	EUR 928

Rabbit Annexin A6, ANXA6 ELISA KIT
ELI-04771Ra	Lifescience Market	96 Tests	EUR 928

Mouse Annexin A6, Anxa6 ELISA KIT
ELI-04774m	Lifescience Market	96 Tests	EUR 865

Cow Annexin A6 (ANXA6) ELISA Kit
abx517019-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Chicken Annexin A6 (ANXA6) ELISA Kit
abx517020-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Annexin A6 (ANXA6) ELISA Kit
abx517022-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Annexin A6 (ANXA6) ELISA Kit
abx517023-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Annexin A6 (ANXA6) Protein
20-abx166675	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Annexin A6 (ANXA6) CLIA Kit
20-abx493630	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human ANXA6 (Annexin A6)
ELK3041	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Annexin A6 (ANXA6). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Annexin A6 (ANX Show more
Description: A sandwich ELISA kit for detection of Annexin A6 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Annexin A6 (ANXA6) Antibody (Biotin)
20-abx105148	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody (FITC)
20-abx106565	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody (HRP)
20-abx107982	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mouse Annexin A6 (ANXA6) Protein
20-abx065385	Abbexa	EUR 718.00 EUR 286.00 EUR 2249.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Annexin A6 (ANXA6) Polyclonal Antibody (Human)
4-PAC345Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANXA6 (Ala2~Ser251) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Annexin A6 (ANXA6)

ANXA6 Annexin A6 Human Recombinant Protein
PROTP08133	BosterBio	Regular: 10ug	EUR 317
Description: ANXA6 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 693 amino acids (1-673 a.a.) and having a molecular mass of 78 kDa._x000D_ ANXA6 is fused to a 20 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

Recombinant Human Annexin A6/ANXA6 (C-6His)
C207-10ug	Novoprotein	10ug	EUR 131
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Annexin A6/ANXA6 (C-6His)
C207-1mg	Novoprotein	1mg	EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Annexin A6/ANXA6 (C-6His)
C207-500ug	Novoprotein	500ug	EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Annexin A6/ANXA6 (C-6His)
C207-50ug	Novoprotein	50ug	EUR 273
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Annexin A6 (ANXA6) Polyclonal Antibody (Human), APC
4-PAC345Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANXA6 (Ala2~Ser251) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Annexin A6 (ANXA6). This antibody is labeled with APC.

Annexin A6 (ANXA6) Polyclonal Antibody (Human), Biotinylated
4-PAC345Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANXA6 (Ala2~Ser251) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Annexin A6 (ANXA6). This antibody is labeled with Biotin.

Annexin A6 (ANXA6) Polyclonal Antibody (Human), Cy3
4-PAC345Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANXA6 (Ala2~Ser251) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Annexin A6 (ANXA6). This antibody is labeled with Cy3.

Annexin A6 (ANXA6) Polyclonal Antibody (Human), FITC
4-PAC345Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANXA6 (Ala2~Ser251) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Annexin A6 (ANXA6). This antibody is labeled with FITC.

Annexin A6 (ANXA6) Polyclonal Antibody (Human), HRP
4-PAC345Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANXA6 (Ala2~Ser251) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Annexin A6 (ANXA6). This antibody is labeled with HRP.

Annexin A6 (ANXA6) Polyclonal Antibody (Human), PE
4-PAC345Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANXA6 (Ala2~Ser251) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Annexin A6 (ANXA6). This antibody is labeled with PE.

Annexin A6 (ANXA6) Polyclonal Antibody (Human, Mouse)
4-PAC345Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANXA6 (Ser251~Leu504) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Annexin A6 (ANXA6)

Polyclonal ANXA6/Annexin A6/Annexin VI Antibody (aa1-50)
APR02865G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ANXA6/Annexin A6/Annexin VI (aa1-50). This antibody is tested and proven to work in the following applications:

Annexin A6 (ANXA6) Polyclonal Antibody (Human), APC-Cy7
4-PAC345Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANXA6 (Ala2~Ser251) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Annexin A6 (ANXA6). This antibody is labeled with APC-Cy7.

Annexin A6 (ANXA6) Polyclonal Antibody (Human, Mouse), APC
4-PAC345Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANXA6 (Ser251~Leu504) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Annexin A6 (ANXA6). This antibody is labeled with APC.

Annexin A6 (ANXA6) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAC345Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANXA6 (Ser251~Leu504) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Annexin A6 (ANXA6). This antibody is labeled with Biotin.

Annexin A6 (ANXA6) Polyclonal Antibody (Human, Mouse), Cy3
4-PAC345Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANXA6 (Ser251~Leu504) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Annexin A6 (ANXA6). This antibody is labeled with Cy3.

Annexin A6 (ANXA6) Polyclonal Antibody (Human, Mouse), FITC
4-PAC345Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANXA6 (Ser251~Leu504) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Annexin A6 (ANXA6). This antibody is labeled with FITC.

Annexin A6 (ANXA6) Polyclonal Antibody (Human, Mouse), HRP
4-PAC345Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANXA6 (Ser251~Leu504) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Annexin A6 (ANXA6). This antibody is labeled with HRP.

Annexin A6 (ANXA6) Polyclonal Antibody (Human, Mouse), PE
4-PAC345Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANXA6 (Ser251~Leu504) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Annexin A6 (ANXA6). This antibody is labeled with PE.

Annexin A6 (ANXA6) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAC345Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANXA6 (Ser251~Leu504) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Annexin A6 (ANXA6). This antibody is labeled with APC-Cy7.

Recombinant Human ANXA6/ Annexin A6/ Annexin6 Protein, GST, E.coli-100ug
QP8334-ec-100ug	EnQuireBio	100ug	EUR 408

Recombinant Human ANXA6/ Annexin A6/ Annexin6 Protein, GST, E.coli-10ug
QP8334-ec-10ug	EnQuireBio	10ug	EUR 200

Recombinant Human ANXA6/ Annexin A6/ Annexin6 Protein, GST, E.coli-1mg
QP8334-ec-1mg	EnQuireBio	1mg	EUR 1632

Recombinant Human ANXA6/ Annexin A6/ Annexin6 Protein, GST, E.coli-200ug
QP8334-ec-200ug	EnQuireBio	200ug	EUR 634

Recombinant Human ANXA6/ Annexin A6/ Annexin6 Protein, GST, E.coli-500ug
QP8334-ec-500ug	EnQuireBio	500ug	EUR 1060

Recombinant Human ANXA6/ Annexin A6/ Annexin6 Protein, GST, E.coli-50ug
QP8334-ec-50ug	EnQuireBio	50ug	EUR 263

Annexin A6
PR27215	Neuromics	2 ug	EUR 191

Annexin A6 Cell ELISA Kit
abx595033-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

Recombinant Human Annexin A6
7-04336	CHI Scientific	2µg	Ask for price

Recombinant Human Annexin A6
7-04337	CHI Scientific	10µg	Ask for price

Recombinant Human Annexin A6
7-04338	CHI Scientific	1mg	Ask for price

Annexin A6 antibody
70R-1672	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal Annexin A6 antibody raised against the C terminal of ANXA6

Annexin A6 antibody
70R-1673	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal Annexin A6 antibody raised against the N terminal of ANXA6

Annexin A6 antibody
70R-31098	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal Annexin A6 antibody

Annexin A6 antibody
70R-13975	Fitzgerald	100 ug	EUR 322
Description: Affinity purified Rabbit polyclonal Annexin A6 antibody

Annexin A6 Antibody
33322-100ul	SAB	100ul	EUR 252

Annexin A6 Antibody
33322-50ul	SAB	50ul	EUR 187

Annexin A6 antibody
70R-49371	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal Annexin A6 antibody

Annexin A6 Antibody
AF0116	Affbiotech	200ul	EUR 304
Description: Annexin A6 antibody detects endogenous levels of total Annexin A6.

Annexin A6 Protein
20-abx262873	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

Annexin A6 Antibody
ABF0116	Lifescience Market	100 ug	EUR 438

Annexin VI (ANXA6) Antibody
abx037409-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Annexin VI (ANXA6) Antibody
abx230438-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Anti-Annexin VI/ANXA6 Antibody
A03735	BosterBio	100ug/vial	EUR 334

Anti-Annexin VI/ANXA6 Antibody
PA1436	BosterBio	100ug/vial	EUR 334

Annexin A6 Blocking Peptide
33R-8376	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ANXA6 antibody, catalog no. 70R-1672

Annexin A6 Polyclonal Antibody
42163-100ul	SAB	100ul	EUR 333

Polyclonal Annexin A6 Antibody
APR05492G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Annexin A6 . This antibody is tested and proven to work in the following applications:

Annexin A6 Blocking Peptide
20-abx062246	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

Annexin A6 Blocking Peptide
AF0116-BP	Affbiotech	1mg	EUR 195

Annexin A6 Conjugated Antibody
C33322	SAB	100ul	EUR 397

Annexin A6 Colorimetric Cell-Based ELISA Kit
EKC1030	BosterBio	100ul	EUR 572

Anxa6/ Rat Anxa6 ELISA Kit
ELI-04773r	Lifescience Market	96 Tests	EUR 886

Annexin A6 Colorimetric Cell-Based ELISA Kit (OKAG00523)
OKAG00523	Aviva Systems Biology	96 Wells	EUR 596
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Type: Cell-Based Subtype: None Detection Method: Colorimetric 450 nm;Sensitivity:

Annexin A6 protein (His tag)
80R-1242	Fitzgerald	50 ug	EUR 397
Description: Purified recombinant Human Annexin A6 protein

Human ANXA6 ELISA Kit
ELA-E1458h	Lifescience Market	96 Tests	EUR 824

ANXA6 ELISA KIT|Human
EF003038	Lifescience Market	96 Tests	EUR 689

ANXA6 ELISA Kit (Human) (OKAN04778)
OKAN04778	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: Annexin VI belongs to a family of calcium-dependent membrane and phospholipid binding proteins. Several members of the annexin family have been implicated in membrane-related events along exocytotic and endocytotic pathways. The annexin VI gene is approximately 60 kbp long and contains 26 exons. It encodes a protein of about 68 kDa that consists of eight 68-amino acid repeats separated by linking sequences of variable lengths. It is highly similar to human annexins I and II sequences, each of which contain four such repeats. Annexin VI has been implicated in mediating the endosome aggregation and vesicle fusion in secreting epithelia during exocytosis. Alternatively spliced transcript variants have been described.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

ANXA6 ELISA Kit (Human) (OKCD08095)
OKCD08095	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Recombinant Human Annexin A6;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL

Carboxypeptidase A6 ELISA KIT|Human
EF008385	Lifescience Market	96 Tests	EUR 689

ANXA6 ELISA Kit (Mouse) (OKEH05482)
OKEH05482	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: May associate with CD21. May regulate the release of Ca2+ from intracellular stores. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

ANXA6 ELISA Kit (Rat) (OKEH06164)
OKEH06164	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: May associate with CD21. May regulate the release of Ca2+ from intracellular stores. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.079 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human Golgin A6 (GOLGA6)ELISA Kit
201-12-2731	SunredBio	96 tests	EUR 440
This Golgin A6 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Ribonuclease A6 (RNASE6) ELISA Kit
DLR-RNASE6-Hu-48T	DL Develop	48T	EUR 517
Should the Human Ribonuclease A6 (RNASE6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease A6 (RNASE6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Ribonuclease A6 (RNASE6) ELISA Kit
DLR-RNASE6-Hu-96T	DL Develop	96T	EUR 673
Should the Human Ribonuclease A6 (RNASE6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease A6 (RNASE6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Carboxypeptidase A6(CPA6) ELISA kit
E01C1994-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxypeptidase A6(CPA6) ELISA kit
E01C1994-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxypeptidase A6(CPA6) ELISA kit
E01C1994-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease A6 (RNASE6) ELISA Kit
20-abx152965	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Serpin A6 PicoKine ELISA Kit
EK1963	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human Serpin A6 in cell culture supernates, serum and plasma (heparin, EDTA) and urine.

Human Carboxypeptidase A6, CPA6 ELISA KIT
ELI-25531h	Lifescience Market	96 Tests	EUR 824

Human Carboxypeptidase A6 (CPA6) ELISA Kit
20-abx386292	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human Carboxypeptidase A6(CPA6)ELISA Kit
QY-E01346	Qayee Biotechnology	96T	EUR 361

Human Ribonuclease A6(RNASE6)ELISA Kit
QY-E03170	Qayee Biotechnology	96T	EUR 361

Human Golgin A6(GOLGA6)ELISA Kit
QY-E03373	Qayee Biotechnology	96T	EUR 361

Human Ribonuclease A6 ELISA Kit (RNASE6)
RK02202	Abclonal	96 Tests	EUR 521

Human Ribonuclease A6 (RNASE6) ELISA Kit
SED192Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease A6 (RNASE6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease A6 (RNASE6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Ribonuclease A6 (RNASE6) ELISA Kit
SED192Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease A6 (RNASE6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease A6 (RNASE6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Ribonuclease A6 (RNASE6) ELISA Kit
SED192Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease A6 (RNASE6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease A6 (RNASE6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Ribonuclease A6 (RNASE6) ELISA Kit
SED192Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease A6 (RNASE6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease A6 (RNASE6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Ribonuclease A6 (RNASE6) ELISA Kit
4-SED192Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Ribonuclease A6 elisa. Alternative names of the recognized antigen: RNS6 Rnase-A6 RNase K6 Ribonuclease, RNase A Family, K6
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ribonuclease A6 (RNASE6) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Ribonuclease A6 (RNASE6) ELISA Kit
RDR-RNASE6-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Ribonuclease A6 (RNASE6) ELISA Kit
RDR-RNASE6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Ribonuclease A6 (RNASE6) ELISA Kit
RD-RNASE6-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Ribonuclease A6 (RNASE6) ELISA Kit
RD-RNASE6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Anxa6 antibody
20R-1257	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal Anxa6 antibody

ANXA6 Antibody
31030-100ul	SAB	100ul	EUR 252

ANXA6 Antibody
31030-50ul	SAB	50ul	EUR 187

ANXA6 antibody
70R-15739	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal ANXA6 antibody

ANXA6 Antibody
32824-100ul	SAB	100ul	EUR 252

ANXA6 antibody
10R-10668	Fitzgerald	100 ug	EUR 381
Description: Mouse monoclonal ANXA6 antibody

ANXA6 Antibody
1-CSB-PA000881	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ANXA6. Recognizes ANXA6 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

ANXA6 Antibody
1-CSB-PA001847ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ANXA6. Recognizes ANXA6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

ANXA6 Antibody
1-CSB-PA001847GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ANXA6. Recognizes ANXA6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

ANXA6 Antibody
CSB-PA904851-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against ANXA6. Recognizes ANXA6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

ANXA6 Antibody
CSB-PA904851-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against ANXA6. Recognizes ANXA6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

ANXA6 Antibody
CSB-PA153225-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against ANXA6. Recognizes ANXA6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

ANXA6 Antibody
CSB-PA153225-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against ANXA6. Recognizes ANXA6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

ANXA6 Antibody
1-CSB-PA197126	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ANXA6. Recognizes ANXA6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:500, IHC:1:25-1:100

ANXA6 Antibody
1-CSB-PA217773	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ANXA6. Recognizes ANXA6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:500, IHC:1:25-1:100

ANXA6 Antibody
1-CSB-PA00794A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ANXA6. Recognizes ANXA6 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

ANXA6 siRNA
20-abx907675	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ANXA6 siRNA
20-abx907676	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Human ANXA6 shRNA Plasmid
20-abx950211	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ANXA6 Recombinant Protein (Human)
RP001378	ABM	100 ug	Ask for price

Human Annexin ?,ANX-? ELISA Kit
201-12-1108	SunredBio	96 tests	EUR 440
This Annexin ? ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Annexin 2 ELISA kit
E01A0055-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Annexin 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin 2 ELISA kit
E01A0055-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Annexin 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin A1 ELISA kit
E01A0208-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Annexin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin A1 ELISA kit
E01A0208-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Annexin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin V ELISA kit
E01A0209-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Annexin V in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin V ELISA kit
E01A0209-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Annexin V in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin A7 ELISA kit
E01A0210-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Annexin A7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin A7 ELISA kit
E01A0210-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Annexin A7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin V ELISA kit
E01A0593-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Annexin V in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin V ELISA kit
E01A0593-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Annexin V in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin V ELISA kit
E01A0593-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Annexin V in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin A2 ELISA kit
E01A0594-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Annexin A2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin A2 ELISA kit
E01A0594-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Annexin A2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin A2 ELISA kit
E01A0594-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Annexin A2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Annexin A10 ELISA KIT|Human
EF007784	Lifescience Market	96 Tests	EUR 689

Annexin A11 ELISA KIT|Human
EF007785	Lifescience Market	96 Tests	EUR 689

Annexin A13 ELISA KIT|Human
EF007786	Lifescience Market	96 Tests	EUR 689

Annexin VII ELISA KIT|Human
EF007788	Lifescience Market	96 Tests	EUR 689

Annexin VIII ELISA KIT|Human
EF007789	Lifescience Market	96 Tests	EUR 689

Human Protein S100-A6 (S100A6) ELISA Kit
abx251242-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ELISA kit for Human Protein S100-A6
EK3954	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protein S100-A6 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human S100A6/ Protein S100-A6 ELISA Kit
E2196Hu	Sunlong	1 Kit	EUR 571

Human S100A6(Protein S100-A6) ELISA Kit
EH1923	FN Test	96T	EUR 524.1
Detection range: 62.5-4000 pg/ml Uniprot ID: P06703 Alias: S100A6/S100 Calcium Binding Protein A6/CACY/MLN 4/PRA/2A9/CABP/CACY5B10/Calcyclin/Growth factor-inducible protein 2A9/PRAS100 calcium binding protein A6/Prolactin receptor-associated protein/ Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 37.5pg/ml

Human Protein S100- A6, S100A6 ELISA KIT
ELI-05741h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human RNASE6 (Ribonuclease A6)
ELK4520	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Ribonuclease A6 (RNASE6). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ribonucle Show more
Description: A sandwich ELISA kit for detection of Ribonuclease A6 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human EPH Receptor A6 (EPHA6) ELISA Kit
abx387162-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Protocadherin gamma- A6, PCDHGA6 ELISA KIT
ELI-35636h	Lifescience Market	96 Tests	EUR 824

Anxa6 Blocking Peptide
33R-5065	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Anxa6 antibody, catalog no. 20R-1257

ANXA6 Conjugated Antibody
C32824	SAB	100ul	EUR 397

ANXA6 Conjugated Antibody
C31030	SAB	100ul	EUR 397

ANXA6 cloning plasmid
CSB-CL001847HU-10ug	Cusabio	10ug	EUR 474
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2022 Sequence: atggccaaaccagcacagggtgccaagtaccggggctccatccatgacttcccaggctttgaccccaaccaggatgccgaggctctgtacactgccatgaagggctttggcagtgacaaggaggccatactggacataatcacctcacggagcaacaggcagaggcaggaggtct Show more
Description: A cloning plasmid for the ANXA6 gene.

ANXA6 Polyclonal Antibody
A53041	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

ANXA6 Rabbit pAb
A5390-100ul	Abclonal	100 ul	EUR 308

ANXA6 Rabbit pAb
A5390-200ul	Abclonal	200 ul	EUR 459

ANXA6 Rabbit pAb
A5390-20ul	Abclonal	20 ul	EUR 183

ANXA6 Rabbit pAb
A5390-50ul	Abclonal	50 ul	EUR 223

pCMV-SPORT6-ANXA6
PVT13946	Lifescience Market	2 ug	EUR 391

Anti-ANXA6 antibody
STJ11100042	St John's Laboratory	100 µl	EUR 413
Description: Annexin VI belongs to a family of calcium-dependent membrane and phospholipid binding proteins. Several members of the annexin family have been implicated in membrane-related events along exocytotic and endocytotic pathways. The annexin VI gene is approximately 60 kbp long and contains 26 exons. It encodes a protein of about 68 kDa that consists of eight 68-amino acid repeats separated by linking sequences of variable lengths. It is highly similar to human annexins I and II sequences, each of which contain four such repeats. Annexin VI has been implicated in mediating the endosome aggregation and vesicle fusion in secreting epithelia during exocytosis. Alternatively spliced transcript variants have been described.

Anti-ANXA6 antibody
STJ27343	St John's Laboratory	100 µl	EUR 277
Description: Annexin VI belongs to a family of calcium-dependent membrane and phospholipid binding proteins. Several members of the annexin family have been implicated in membrane-related events along exocytotic and endocytotic pathways. The annexin VI gene is approximately 60 kbp long and contains 26 exons. It encodes a protein of about 68 kDa that consists of eight 68-amino acid repeats separated by linking sequences of variable lengths. It is highly similar to human annexins I and II sequences, each of which contain four such repeats. Annexin VI has been implicated in mediating the endosome aggregation and vesicle fusion in secreting epithelia during exocytosis. Alternatively spliced transcript variants have been described.

Anti-ANXA6 Antibody
STJ500096	St John's Laboratory	100 µg	EUR 476

Annexin V ELISA kit
55R-IB49646	Fitzgerald	96 wells	EUR 1178
Description: ELISA kit for the detection of Annexin V in the research laboratory

Annexin V ELISA kit
55R-ORG643	Fitzgerald	96 wells	EUR 451
Description: ELISA kit for the detection of Annexin V in the research laboratory

Rat Carboxypeptidase A6(CPA6) ELISA kit
E02C1994-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxypeptidase A6(CPA6) ELISA kit
E02C1994-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxypeptidase A6(CPA6) ELISA kit
E02C1994-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Carboxypeptidase A6(CPA6) ELISA kit
E03C1994-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Carboxypeptidase A6(CPA6) ELISA kit
E03C1994-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Carboxypeptidase A6(CPA6) ELISA kit
E03C1994-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Carboxypeptidase A6(CPA6) ELISA kit
E06C1994-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Carboxypeptidase A6(CPA6) ELISA kit
E06C1994-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Carboxypeptidase A6(CPA6) ELISA kit
E06C1994-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Carboxypeptidase A6(CPA6) ELISA kit
E04C1994-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Carboxypeptidase A6(CPA6) ELISA kit
E04C1994-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Carboxypeptidase A6(CPA6) ELISA kit
E04C1994-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ANXA6(Annexin A6) ELISA Kit