Human LACRT(Lacritin) ELISA Kit

Human LACRT(Lacritin) ELISA Kit

To Order: Contact us

Human Lacritin (LACRT) ELISA Kit
RD-LACRT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Lacritin (LACRT) ELISA Kit
RD-LACRT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Lacritin (LACRT) ELISA Kit
RDR-LACRT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Lacritin (LACRT) ELISA Kit
RDR-LACRT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Lacritin (LACRT) ELISA Kit
20-abx152147	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Lacritin (LACRT) ELISA Kit
SEC576Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lacritin (LACRT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lacritin (LACRT) in saliva, tears and other biological fluids.

Human Lacritin (LACRT) ELISA Kit
SEC576Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lacritin (LACRT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lacritin (LACRT) in saliva, tears and other biological fluids.

Human Lacritin (LACRT) ELISA Kit
SEC576Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lacritin (LACRT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lacritin (LACRT) in saliva, tears and other biological fluids.

Human Lacritin (LACRT) ELISA Kit
SEC576Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lacritin (LACRT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lacritin (LACRT) in saliva, tears and other biological fluids.

Human Lacritin (LACRT) ELISA Kit
4-SEC576Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Lacritin elisa. Alternative names of the recognized antigen: Extracellular glycoprotein lacritin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Lacritin (LACRT) in samples from saliva, tears and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Lacritin(LACRT)ELISA Kit
QY-E04824	Qayee Biotechnology	96T	EUR 361

Lacritin (LACRT) Antibody
20-abx113422	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Lacritin (LACRT) Antibody
20-abx128613	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Lacritin (LACRT) Antibody
20-abx173283	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Lacritin (LACRT)
4-RPC576Hu01	Cloud-Clone	EUR 519.33 EUR 242.00 EUR 1672.48 EUR 624.16 EUR 1148.32 EUR 410.00 EUR 4031.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9GZZ8 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 44.7kDa Isoelectric Point: 6.1
Description: Recombinant Human Lacritin expressed in: E.coli

Human Lacritin (LACRT) Protein
20-abx167137	Abbexa	EUR 718.00 EUR 286.00 EUR 2249.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Lacritin (LACRT) CLIA Kit
20-abx493773	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human LACRT (Lacritin)
ELK2907	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Lacritin (LACRT). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Lacritin (LACRT). Show more
Description: A sandwich ELISA kit for detection of Lacritin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human LACRT (Extracellular glycoprotein lacritin) ELISA Kit
ELI-42678h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human Extracellular glycoprotein lacritin (LACRT)
KTE61868-48T	Abbkine	48T	EUR 332
Lacritin is a 12.3 kDa glycoprotein encoded in humans by the LACRT gene. Lacritin is a secreted protein found in tears and saliva. Lacritin also promotes tear secretion and proliferation of some epithelial cells. Lacritin is thus a prosecretory mitog Show more
Description: Quantitative sandwich ELISA for measuring Human Extracellular glycoprotein lacritin (LACRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Extracellular glycoprotein lacritin (LACRT)
KTE61868-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Lacritin is a 12.3 kDa glycoprotein encoded in humans by the LACRT gene. Lacritin is a secreted protein found in tears and saliva. Lacritin also promotes tear secretion and proliferation of some epithelial cells. Lacritin is thus a prosecretory mitog Show more
Description: Quantitative sandwich ELISA for measuring Human Extracellular glycoprotein lacritin (LACRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Extracellular glycoprotein lacritin (LACRT)
KTE61868-96T	Abbkine	96T	EUR 539
Lacritin is a 12.3 kDa glycoprotein encoded in humans by the LACRT gene. Lacritin is a secreted protein found in tears and saliva. Lacritin also promotes tear secretion and proliferation of some epithelial cells. Lacritin is thus a prosecretory mitog Show more
Description: Quantitative sandwich ELISA for measuring Human Extracellular glycoprotein lacritin (LACRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Extracellular Glycoprotein Lacritin (LACRT) Antibody
abx234671-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Lacritin (LACRT) Polyclonal Antibody (Human, Mouse)
4-PAC576Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LACRT (Glu20~Ala138) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT)

Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), APC
4-PAC576Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LACRT (Glu20~Ala138) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with APC.

Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAC576Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LACRT (Glu20~Ala138) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with Biotin.

Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), Cy3
4-PAC576Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LACRT (Glu20~Ala138) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with Cy3.

Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), FITC
4-PAC576Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LACRT (Glu20~Ala138) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with FITC.

Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), HRP
4-PAC576Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LACRT (Glu20~Ala138) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with HRP.

Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), PE
4-PAC576Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LACRT (Glu20~Ala138) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with PE.

Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAC576Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LACRT (Glu20~Ala138) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with APC-Cy7.

LACRT ELISA KIT|Human
EF010606	Lifescience Market	96 Tests	EUR 689

LACRT ELISA Kit (Human) (OKCD00685)
OKCD00685	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Modulates secretion by lacrimal acinar cells. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.63 ng/mL

LACRT ELISA Kit (Human) (OKDD00367)
OKDD00367	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: The protein encoded by this gene is highly expressed in the lacrimal glands and localized primarily to secretory granules and secretory fluid. It augments lacrimal acinar cell secretion, promotes ductal cell proliferation, and stimulates signaling through tyrosine phosphorylation and release of calcium.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.055 ng/mL

LACRT siRNA
20-abx922200	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LACRT antibody
70R-18201	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal LACRT antibody

LACRT Antibody
1-CSB-PA012715GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against LACRT. Recognizes LACRT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

Human LACRT shRNA Plasmid
20-abx963898	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

LACRT Recombinant Protein (Human)
RP017461	ABM	100 ug	Ask for price

LACRT Recombinant Protein (Human)
RP017464	ABM	100 ug	Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

anti- LACRT antibody
FNab04671	FN Test	100µg	EUR 585
Immunogen: lacritin Uniprot ID: Q9GZZ8 Gene ID: 90070 Research Area: Epigenetics, Signal Transduction
Description: Antibody raised against LACRT

LACRT Rabbit pAb
A14632-100ul	Abclonal	100 ul	EUR 308

LACRT Rabbit pAb
A14632-200ul	Abclonal	200 ul	EUR 459

LACRT Rabbit pAb
A14632-20ul	Abclonal	20 ul	EUR 183

LACRT Rabbit pAb
A14632-50ul	Abclonal	50 ul	EUR 223

LACRT Polyclonal Antibody
28656-100ul	SAB	100ul	EUR 252

LACRT Polyclonal Antibody
28656-50ul	SAB	50ul	EUR 187

LACRT cloning plasmid
CSB-CL887939HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 417 Sequence: atgaaatttaccactctcctcttcttggcagctgtagcaggggccctggtctatgctgaagatgcctcctctgactcgacgggtgctgatcctgcccaggaagctgggacctctaagcctaatgaagagatctcaggtccagcagaaccagcttcacccccagagacaaccacaac Show more
Description: A cloning plasmid for the LACRT gene.

LACRT cloning plasmid
CSB-CL887939HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 417 Sequence: atgaaatttaccactctcctcttcttggcagctgtagcaggggccctggtctatgctgaagatgcctcctctgactcgacgggtgctgatcctgcccaggaagctgggacctctaagcctaatgaagagatctcaggtccagcagaaccagcttcacccccagagacaaccacaac Show more
Description: A cloning plasmid for the LACRT gene.

Anti-LACRT antibody
PAab04671	Lifescience Market	100 ug	EUR 412

Anti-LACRT antibody
STJ116839	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is highly expressed in the lacrimal glands and localized primarily to secretory granules and secretory fluid. It augments lacrimal acinar cell secretion, promotes ductal cell proliferation, and stimulates signaling through tyrosine phosphorylation and release of calcium.

LACRT ORF Vector (Human) (pORF)
ORF005821	ABM	1.0 ug DNA	EUR 95

LACRT ORF Vector (Human) (pORF)
ORF005822	ABM	1.0 ug DNA	EUR 95

LACRT Polyclonal Conjugated Antibody
C28656	SAB	100ul	EUR 397

LACRT sgRNA CRISPR Lentivector set (Human)
K1192801	ABM	3 x 1.0 ug	EUR 339

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

LACRT sgRNA CRISPR Lentivector (Human) (Target 1)
K1192802	ABM	1.0 ug DNA	EUR 154

LACRT sgRNA CRISPR Lentivector (Human) (Target 2)
K1192803	ABM	1.0 ug DNA	EUR 154

LACRT sgRNA CRISPR Lentivector (Human) (Target 3)
K1192804	ABM	1.0 ug DNA	EUR 154

LACRT Protein Vector (Human) (pPB-C-His)
PV023281	ABM	500 ng	EUR 329

LACRT Protein Vector (Human) (pPB-N-His)
PV023282	ABM	500 ng	EUR 329

LACRT Protein Vector (Human) (pPM-C-HA)
PV023283	ABM	500 ng	EUR 329

LACRT Protein Vector (Human) (pPM-C-His)
PV023284	ABM	500 ng	EUR 329

LACRT Protein Vector (Human) (pPB-C-His)
PV023285	ABM	500 ng	EUR 329

LACRT Protein Vector (Human) (pPB-N-His)
PV023286	ABM	500 ng	EUR 329

LACRT Protein Vector (Human) (pPM-C-HA)
PV023287	ABM	500 ng	EUR 329

LACRT Protein Vector (Human) (pPM-C-His)
PV023288	ABM	500 ng	EUR 329

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Human LACRT(Lacritin) ELISA Kit